Labshake search
Citations for The Jackson Laboratory :
1 - 50 of 562 citations for Human Immunodeficiency Virus Reverse Transcriptase Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: Female non-obese diabetic-severe combined immunodeficiency gammanull (NSG, The Jackson Laboratory), BALB/c (Janvier Labs or Envigo ...
-
bioRxiv - Cancer Biology 2021Quote: Non-obese diabetic-severe combined immunodeficiency (NOD-SCID)-gamma (NSG) immunocompromised mice (strain 005557; The Jackson Laboratory) were housed in vented cages and bred in-house ...
-
bioRxiv - Neuroscience 2020Quote: ... PSEN1dE9)85Dbo/Mmjax) expressing a chimeric mouse/human amyloid precursor protein and a mutant human presenilin 1 were source from Jackson Laboratory (RRID ...
-
bioRxiv - Cancer Biology 2022Quote: ... Non-obese diabetic (NOD)/severe combined immunodeficiency (SCID) mice were purchased from The Jackson Laboratory (The Jackson Laboratory, Bar Harbor, ME, USA). 8-week-old NOD/SCID mice (2 – 3 males and 2 – 3 females per treatment group ...
-
bioRxiv - Microbiology 2022Quote: ... we as ambled complexes using FAM-labeled ssRNA as and then treated 4-week-old mice with a single dose of PTR containing FAM-labeled ssRNA/Ago (ssRNA [100nM]/Ago [125 ng] diluted in 100 μl of PBS) was given to severe combined immunodeficiency/beige (SCIDbg) mice (Jackson lab, Sacramento, California USA) by oral gavage ...
-
bioRxiv - Cancer Biology 2023Quote: ... Non-obese diabetic (NOD)/severe combined immunodeficiency (SCID) mice (JAX: 001303) were purchased from The Jackson Laboratory (The Jackson Laboratory, Bar Harbor, ME, USA). 8-week-old NOD/SCID mice (2-3 males per group and 2-3 females per group ...
-
bioRxiv - Cancer Biology 2023Quote: ... were established from T-ALL biopsy samples in nonobese diabetic/severe combined immunodeficiency / interleukin-2Rγ null mice (NSG, The Jackson Laboratory, Bar Harbor, USA) that are produced in pathogen-free animal facilities (Commissariat à l’Energie Atomique et aux Energies Alternatives [CEA] ...
-
bioRxiv - Genomics 2021Quote: ... including the FVB/N-Tg(HIV)26Aln/PkltJ (The Jackson Laboratory stock No: 022354) “Tg26” mouse ...
-
bioRxiv - Immunology 2024Quote: ... Postnatal pups were used from the NF-kB reporter strain FVB.Cg-Tg(HIV-EGFP,luc)8Tsb/J58 (The Jackson Laboratory, #027529) at P0-P3 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and anti-human DyLight 649 (Jackson Labs, 109-495-088; 1:200). Coverslips were mounted with ProLong Diamond antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... followed by an Alexa647-conjugated goat anti-human IgG (Jackson Laboratories; 1:400) were successively incubated with cells for labelling ...
-
bioRxiv - Microbiology 2023Quote: ... the caveolae protein 1 (Cav1) knock-out (Cav-1−/−; the Jackson Laboratory strain # 007083) or the 210-kDa MLCK−/− mice (6,45 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Fmr1 KO (B.6129P2-Fmr1tm1Cgr/J, Jackson Laboratory) mice between the ages of 2-5 months were used ...
-
bioRxiv - Biochemistry 2021Quote: ... B6 was used as primary Ab (1:500 dilution) and an Alexa Fluor 680-conjugated goat anti-human secondary Ab (1:50,000 dilution, Jackson Laboratory) were used for western blotting ...
-
bioRxiv - Molecular Biology 2023Quote: ... male Slc25a4 p.A114P,A123D/+ mice were crossed with female C57BL/6 mice with transgenic expression of the human SNCA gene (coding for the α-synuclein protein) harboring the pathogenic A53T mutation (Jackson Lab #006823) 29 ...
-
bioRxiv - Neuroscience 2023Quote: ... plates were incubated with anti-mouse IgG or anti-human IgG (1:5000 in 1% BSA; Jackson Laboratory, Bar Harbor, ME) for 1 hour at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... Pellet was resuspended with 100 µL of antibody master mix containing (1:30 dilution of Anti-Human IgA, APC [Miltenyi, Cat#130-113-472], 1:30 dilution mouse serum [Jackson labs, Cat #15000120] ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Reverse (oIMR8546, The Jackson Laboratory) - 5’-GGAGCGGGAGAAATGGATATG-3’ ...
-
bioRxiv - Neuroscience 2023Quote: Virus injection and optic fiber implantation surgery was performed in C57BL/6J mice (The Jackson Laboratory, #000664) at around P60 ...
-
bioRxiv - Cancer Biology 2023Quote: These studies were conducted using C57BL/6 and Tyrosinase-related protein 1 (TRP-1) TCR transgenic mice (Rag-/- BWTRP-1 TCR) purchased from Jackson laboratories. The TRP-1 TCR transgenic mice (Rag-/- BWTRP-1 TCR ...
-
bioRxiv - Neuroscience 2023Quote: ... Cochlear tissue with fluorescent SGNs was obtained from different mouse lines: 1) Microtubule-Associated Protein Tau driving the Green Fluorescent Protein expression (Mapt-GFP+/+, Jackson laboratory, #029219). MAPT is a protein involved in microtubule assembly and stability in neurons28 ...
-
bioRxiv - Cancer Biology 2023Quote: ... R26-Pik3caH1047R Mutant Reverse (oIMR8052, The Jackson Laboratory) - GCGAAGAGTTTGTCCTCAACC ...
-
bioRxiv - Genomics 2019Quote: ... genes that had no expert curated 1:1 orthologs between mouse and human (Mouse Genome Informatics, The Jackson laboratory, version 11/22/2016). Gene expression was then scaled to a total of 1M UMIs (or transcript per million (TPM) ...
-
bioRxiv - Immunology 2019Quote: ... The B cell deficient B6.129S2 – Ighmtm1Cgn/J mouse μMT (The Jackson Laboratory) was used as a donor and recipient in bone marrow transplantation ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... which expresses human ACE2 driven by a human cytokeratin 18 (K18) promoter (Jackson Laboratory, https://www.jax.org/strain/034860) were housed in an animal facility of biosafety level 3 (BSL3 ...
-
bioRxiv - Bioengineering 2021Quote: ... and muMt− (B cell KO) on C57BL/6J background (The Jackson Laboratory, stock #002288). Bilateral traumatic muscle defects were created as previously described (22 ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous arylsulfatase B deficient mice were obtained (Strain 005598; Jackson Laboratories, Bar Harbor, Maine) and bred ...
-
bioRxiv - Immunology 2019Quote: ... Plates were washed as above and incubated for 2h with 1:500 dilution of an alkaline phosphatase-conjugated goat F(ab′)2 anti-human IgG (Jackson Laboratories). Plates were washed and developed for 15 min with 100 μl/well of a Sigmafast p-nitrophenyl phosphate solution (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: Transgenic R6/1 mice (B6-CBA-Tg (HDexon1) 61Gpb/1J) expressing a transgene containing the human HD gene were obtained from Jackson Laboratory (RRID ...
-
bioRxiv - Cancer Biology 2020Quote: PyMT GEMM mice were bred by crossing male transgenic mice expressing the polyoma virus middle T antigen (PyMT) oncoprotein under the MMTV-LTR (Jackson Laboratory 022974) with wildtype females on a similar B6/FVB mixed background ...
-
bioRxiv - Genetics 2021Quote: ... mouse B (Supplemental Table 19) was subsequently mated to an SJL/J male (Jackson Laboratory), and the F2 offspring from the heterozygous F1 crosses ...
-
bioRxiv - Neuroscience 2019Quote: ... Heterozygous transgene mice were then bred to mouse expressing FLP-1 recombinase gene under the direction of the human ACTB promoter (The Jackson Laboratory #005703), to create a mouse line where the third exon PI31 is flanked by two LoxP sites (PI31fl/fl) ...
-
bioRxiv - Biophysics 2020Quote: ... Splenic B cells were obtained from 6- to 10-week old C57BL/6 mice (Jackson Laboratory) of either sex using a B-cell isolation kit (Stemcell Technologies ...
-
bioRxiv - Immunology 2020Quote: C57BL/6 (H-2b/b) and CB6F1 (H-2b/d) mice were purchased from Jackson Laboratory and inoculated at 8 weeks of age ...
-
bioRxiv - Immunology 2022Quote: ... and blotted with anti-human IgG Fc (Jackson labs). (E ...
-
bioRxiv - Neuroscience 2023Quote: ... Stereotactic cranial window surgery and intracortical delivery of adeno-associated virus (AAV) was performed on adult (≥ 90 days old) VGAT-Cre mice (Slc32a1-IRES-Cre, Jackson Laboratory, Stock No. 028862) backcrossed to C57BL6/N background (N=4) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NOD.Cg-Prkdcscid IL2rgtm1Wjl/SzJ: NOD scid gamma (NSG; lacks NK, T, and B cells; Jackson Laboratories).
-
bioRxiv - Cell Biology 2022Quote: ... Lsd1 floxed mice were crossed with B.6129-Lyzstm1(cre)lfo/J mice (LysM-cre) (Jackson Laboratories) which have Cre-recombinase expressed in myeloid cells ...
-
bioRxiv - Neuroscience 2022Quote: ... presenilin-1 [PSEN1] and microtubule-associated protein tau [MAPT]) (Mutant Mouse Research and Resource Center at The Jackson Laboratory) was used as control.
-
bioRxiv - Cell Biology 2020Quote: ... and transgenic mice that express Cre recombinase under control of the human bestrophin-1 (BEST1) promoter (C57BL/6-Tg(BEST1-cre)1Jdun/J) (Iacovelli et al, 2011) were purchased from Jackson lab (Bar Harbor, ME). CD-1 IGS mice were purchased from Charles River (Wilmington ...
-
bioRxiv - Immunology 2021Quote: ... female Gpr55-/- mice on WT background and B cell-deficient (μMT) female mice (strain # 002288, The Jackson Laboratory) aged 6–8-weeks at the start of experimental regimes were used ...
-
bioRxiv - Neuroscience 2022Quote: ... The iBot mice express cre-dependent BoNT/B-LC followed by an IRES and EGFP reporter (Jackson Laboratory Stock No ...
-
bioRxiv - Cancer Biology 2020Quote: ... Anti-human Fc fragment APC-conjugated (Jackson Laboratory, #109-135-098) was used as a secondary antibody ...
-
bioRxiv - Immunology 2022Quote: ... Anti-human IgG Fc g-specific horseradish peroxidase conjugates (Jackson Laboratory) was used to detect binding of antibody to the RBD proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... The membrane was washed by TBS and then incubated with secondary antibodies (anti-mouse IgG, anti-rat IgG, anti-human IgG, Jackson Laboratory, Bar Harbor, ME; 1:5000) diluted by 1% milk in TBS for 1h at room temperature ...
-
bioRxiv - Neuroscience 2019Quote: ... starting with a human-mouse gene homology list obtained from Jackson Labs (http://www.informatics.jax.org/downloads/reports/index.html#marker) ...
-
bioRxiv - Microbiology 2020Quote: ... or PE-conjugated Goat Anti-Human IgG (Jackson Labs, 109-115-098), and incubated on ice for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... and APC-conjugated Goat Anti-Human IgG (Jackson Labs, 109-115-098), and incubated on ice for 1 h ...
-
bioRxiv - Neuroscience 2019Quote: ... Heterozygous human LRRK2 G2019S BAC transgenic mice (The Jackson Laboratory, cat# 018785) were maintained on a C57BL/6 background (The Jackson Laboratory ...
-
bioRxiv - Immunology 2023Quote: ... Bound antibodies were detected by biotyinylated goat anti-human IgA (Jackson Laboratories) and the addition of peroxidase conjugated avidin:biotin (Vector Laboratories ...