Labshake search
Citations for The Jackson Laboratory :
4751 - 4800 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... B6.129P2(C)-Mecp2tm1.1Bird (stock no. 003890, Jackson Labs, Bar Harbor, ME) and B6J;129S6.Mecp2R168X (stock no ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were purchased from Jackson Labs and backcrossed with male wild-type C57BL/6 mice for one generation (Mecp2R168X ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Wild-type C57BL/6J mice (female, 7 weeks of age) were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and housed under standard conditions (Wenzel et al. ...
-
bioRxiv - Neuroscience 2022Quote: B6SJL-Tg(SOD1)2Gur/J (Tg-SOD1) and B6SJL-Tg(SOD1*G93A)1Gur/J (Tg-SOD1/G93A) mice [8] were obtained from Jackson Laboratories, and they were maintained on a mixed genetic background as recommended ...
-
bioRxiv - Neuroscience 2022Quote: Twenty-one C57BL/6J mice (11 males and 10 females, Jackson Labs) were used in the behavioral testing starting at 3-4 months of age ...
-
bioRxiv - Neuroscience 2022Quote: ... Male and female C57BL/6J mice (8-16 weeks old, 20-30 g, The Jackson Laboratory) were maintained on a 12:12 h light/dark cycle (07:00 lights on ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... Vgat-ires-Cre mice were bred in house from Vgat-ires-Cre x C57BL6/J (Jackson Laboratories, Bar Harbor, ME) pairings ...
-
bioRxiv - Neuroscience 2022Quote: ... Stock No: 003782) were purchased from Jackson Laboratories.
-
bioRxiv - Physiology 2022Quote: Male B6(Cg)-Ins1tm1.1(cre)Thor/J mice (Ins1cre) on C57BL/6J background (MGI:5614359) were purchased from Jackson Laboratory. Atp2a2tm1.1Iemr mice on 129P2/OlaHsd background (MGI:4415164 ...
-
bioRxiv - Physiology 2022Quote: C57BL/6J (#000664, JAX) and Trem2 knockout (#027197, JAX; donating investigator: Mike Sanser) mice were purchased from Jackson Laboratories and bred in our facility to generate male and female WT and Trem2-/- mice as littermate controls ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Neuroscience 2022Quote: Adult male and female C57BL/6J (Jackson Laboratory, JAX: 000664) and Kcna1 -/- (in-house breeding ...
-
bioRxiv - Neuroscience 2022Quote: Male and female C57BL/6J mice (Jackson Laboratory, JAX: 000664) were administered either 15 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Male (n=15) and female (n=12) 6-week-old C57BL/6J mice were purchased from Jackson Laboratory (Bar Harbor, ME) and allowed to grow and acclimate in the vivarium until catheterization surgery at 13-15 weeks of age ...
-
bioRxiv - Neuroscience 2022Quote: ... and are also available from Jackson Laboratories (JAX033342). Mice from the Cdh5BAC-GCaMP strain have constitutive expression of the genetically encoded calcium indicator GCaMP8 by insertion of a GCaMP8 cassette in the calcium-dependent cell adhesion molecule cadherin 5 locus (Cdh5 or VE-cadherin) ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-IRES-Cre were obtained from Jackson laboratory stock #(006410) ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6J wild type male mice were obtained from Jackson Laboratory. Experiments using CCK-Cre mice employed the CCK-IRES-Cre knock-in line (Stock No ...
-
bioRxiv - Neuroscience 2022Quote: ... DRG neurons were collected from Cas9 knock-in mice (Jackson Laboratory) or WT and Stmn2 KO littermates on embryonic day 12.5-13.5 ...
-
bioRxiv - Neuroscience 2022Quote: Forty-eight male C57BL/6J mice from Jackson Laboratories Inc were individually housed ...
-
bioRxiv - Neuroscience 2022Quote: ... SLICK-A transgenic mice (Jackson Laboratories, B6.Cg-Tg(Thy1-cre/ERT2,-EYFP)AGfng/J ...
-
bioRxiv - Neuroscience 2022Quote: ... PDGFRβ-Cre mice (Cuttler et al., 2011) were crossed with Ai95(RCL-GCaMP6f)-D reporter mice (Jackson Laboratory) to obtain PDGFRβ-Cre ...
-
bioRxiv - Neuroscience 2022Quote: ... Cspg4-DsRed mice (C57BL/6J background; Jackson Laboratories), Cspg4-Cre recombinase mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Emx1-Cre (stock number 005628) and tdTomatofl (Ai14-Rosa26-tdTomatofl-stop-fl; stock number 007914) mice were purchased from Jackson Laboratories. Ntsr1-Cre (RRID:MGI_3836636 ...
-
bioRxiv - Molecular Biology 2022Quote: ... on a C57BL/6j genetic background with RCE:loxP (EGFP) animals8 (The Jackson Laboratory mouse strain 32037-JAX) on a C57BL/6xCD1 mixed genetic background ...
-
bioRxiv - Molecular Biology 2022Quote: ... incubated secondary HRP antibody (Jackson Labs 711-035-150), washed once more and imaged.
-
bioRxiv - Neuroscience 2022Quote: ... CHR-Cre were crossed to the Ai9 TdTomato Cre-reporter mice (Jackson Laboratories, #007909) in order to visualize CRH+ neurons ...
-
bioRxiv - Neuroscience 2022Quote: ... All experiments used 6–12-week-old C57BL/6J mice of both sexes obtained from Jackson Laboratories (stock #000664) or from the C57BL/6J colony at UAB ...
-
bioRxiv - Neuroscience 2022Quote: ... Experiments using CCK-Cre mice employed the CCK-IRES-Cre knock-in line (Stock No. 012706, Jackson Laboratory). Knock-in mice were maintained as hemizygotes ...
-
bioRxiv - Neuroscience 2022Quote: ... VGLUT2-Cre knock-in homozygote mice (The Jackson Laboratory, stock #016963) were housed in a 12:12 hour light/dark cycle with food and water ad libitum ...
-
bioRxiv - Neuroscience 2022Quote: ... The HoxB8Cre;Piezof/f and Phox2bCre;Piezo2f/f mouse lines have been previously described (Woo et al., 2015; Zeng et al., 2018) Genotyping was performed using guidelines from Jackson Laboratory. C57BL/6J adult mice were used for all experiments if not otherwise defined in the text.
-
bioRxiv - Neuroscience 2022Quote: ... Lhcgr-/- (strain #027102, Jackson Laboratory), Fshr-/- mice (55 ...
-
bioRxiv - Neuroscience 2022Quote: ... B6.Cg-Npytm1(cre)Zman/J (herein called Npy-IRES-Cre) mice were obtained from Jackson Laboratories (Stock No.: 027851) and have an IRES and a Cre recombinase cassette inserted into the 3’ UTR of the Npy locus downstream of the stop codon ...
-
bioRxiv - Neuroscience 2022Quote: C57BL/6J mice were obtained from Jackson Laboratories (stock #000664). The Ank2 exon 24flox/flox mouse line was a gift from Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... Male C57B6/J wild-type (WT) mice were received from Jackson Laboratories. Male Thy-1-YFP-H (in C57 background ...
-
bioRxiv - Neuroscience 2022Quote: ... mice as well as mice of the same age range from the following transgenic mouse lines: CRH-Cre mice (Jackson Laboratories, #012704) and CRHR1-Cre mice (courtesy of Jan Deussing) ...
-
bioRxiv - Neuroscience 2022Quote: ... both obtained from Jackson Laboratory (Bar Harbor, ME, USA). Transgenic mice and their littermates were used in experiments at the indicated ages ...
-
bioRxiv - Neuroscience 2022Quote: ... C57BL/6J mice (Jackson Laboratory, Bar Harbor, ME, USA; 000664) were seven-weeks old at the start of all studies ...
-
bioRxiv - Neuroscience 2022Quote: ... AgRP-IRES-Cre mice[15] (Jackson Labs Stock 012899) were injected with AAV1-Syn-FLEX-GCaMP6s (Penn Vector Core ...
-
bioRxiv - Neuroscience 2022Quote: Wild type C57Bl/6J (Jackson Laboratories), floxed Zdhhc17 (on an FVB background (Sanders et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... with Rosa26-CAG::loxP-STOP-loxP-tdTomato-WPRE and Cx3cr1::GFP (Jackson Laboratory stock 005582). P60 and P140 mice were perfused transcardially under anesthesia using 4% paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2022Quote: ... BDNFf/f quatriple transgenic mice were generated by crossing Thy1::YFP-H (Jackson Laboratory stock 003782) with Cx3cr1::creER-YFP (Jackson Laboratory stock 021160) ...
-
bioRxiv - Neuroscience 2022Quote: ... with Cx3cr1::creER-YFP (Jackson Laboratory stock 021160), Rosa26-CAG::loxP-STOP-loxP-tdTomato-WPRE (Jackson Laboratory stock 007905 ...
-
bioRxiv - Neuroscience 2022Quote: ... Tissue specific GOF Piezo2 mice were generated by breeding conditional GOF mice into MCKCre (The Jackson Laboratory, stock#006475), Prrx1Cre(The Jackson Laboratory ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice aged embryonic day 10.5 (E10.5) to postnatal day 4 (P4) were harvested from C57/BL6 females (Jackson Labs, 000664) bred in house ...
-
bioRxiv - Immunology 2022Quote: ... and B6.129P2-Lyz2tm1(cre)Ifo/J (LysMCre)92 mice were purchased from Jackson Laboratories. Ifnb1-Tomato-Cre-pA Terminator (I-Tomcat ...
-
bioRxiv - Bioengineering 2022Quote: ... n = 5) (Jackson Labs, Bar Harbor, ME). Acute studies (0 -6 h ...
-
bioRxiv - Molecular Biology 2022Quote: Wild-type (C57BL/6J) and mdx mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA). We have generated and extensively characterized multiple lines of SSPN-transgenic mdx mice expressing either human SSPN (hSSPN ...
-
bioRxiv - Cancer Biology 2022Quote: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice (NOD scid gamma (NSG™)) mice (The Jackson Laboratory, Bar Harbor, ME) aged 8-11 weeks were used for this study ...
-
bioRxiv - Cancer Biology 2022Quote: ... and FVB and C57Bl/6 mice (Jackson Labs) for AK4.4 and KPC murine PDAC cell lines ...
-
bioRxiv - Microbiology 2022Quote: ... were purchased from The Jackson Laboratory (Bar Harbor, ME) and C57BL/6J-IFN-gamma knockout mice (also known as B6.129S7-Ifngtm1Ts/J; The Jackson Laboratory stock No 002287) were bred in-house at the University of Georgia Animal Facility ...