Labshake search
Citations for The Jackson Laboratory :
1101 - 1150 of 1642 citations for Dnp pro leu gly cys me his ala D arg nh2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: C57BL/6J (2 months old and 18 months old, male, 22-30g, strain# 664, Jackson Laboratories; Bar Harbor, ME), B6.Cg-Apoetm1.1(APOE*4)AdiujAppem1AdiujTrem2em1Adiuj/J (18 months old ...
-
bioRxiv - Cancer Biology 2023Quote: ... B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J (Strain # 007676, The Jackson Laboratory, Bar Harbor, ME, USA) mice were used to isolated hepatocytes according to standard protocol ...
-
bioRxiv - Microbiology 2023Quote: C57BL/6J and K18-hACE2 C57BL/6J (strain 2B6.Cg-Tg(K18-ACE2)2Prlmn/J) mice (Jackson Laboratories, ME) were maintained and bred in a conventional animal facility ...
-
bioRxiv - Cell Biology 2023Quote: ... Foxl1- CreERT2 mice43 were crossed with Rosa-mTmG or Porcn-ex3-7Neo-flox48 (Jackson Laboratories Bar Harbor, ME #020994) to obtain Foxl1CreERT2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Brn3a-cKOAP [11] and Ai9 reporter [12] mice were obtained from Jackson Laboratory (010558, 007909; Bar Harbor, ME, USA). Brn3a-Cre knock-in mice were generated as described previously [13] ...
-
bioRxiv - Immunology 2024Quote: ... Female C3H/HeJ mice (n=5 per condition) aged 10 weeks were provided by Jackson Laboratories (Bar Harbor, ME). Mice were anaesthetized by isoflurane inhalation and injected intradermally with 100,000 B ...
-
bioRxiv - Microbiology 2024Quote: Ten weeks old male atherosclerosis-prone ApoE-/- mice on C57BL/6J background (002052; The Jackson Laboratory, Bar Harbor, ME) [27] were used in the present study ...
-
bioRxiv - Microbiology 2024Quote: Five- to six-week-old female NOD.Cg-Prkdcscid Il2rgtm1wjl/SzJ (n = 31; NSG, The Jackson Laboratory, Bar Harbor, ME) and 5- to 6-week-old female Tac:(SW ...
-
bioRxiv - Neuroscience 2024Quote: ... IA) as a ribonucleoprotein (RNP) was electroporated into C57BL/6J (B6J) zygotes (Jackson Lab stock # 000664, Bar Harbor, ME) along with a ssODN sequence (TMF 1341–5’-ACCATGCTGGGCCAGAGCACAGAGGAGATAAGAGCATCTCTCTCCACACACCTGCGCAAG ATGCGCAAGCG —3’) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The mice studied in the embodied work include: C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME, Cat# 000664), global NTSR1-/- mice (B6.129P2-Ntsr1tm1Dgen/J ...
-
bioRxiv - Molecular Biology 2024Quote: Wild-type C57BL/6J (C57nDNA:C57mtDNA) mice were purchased at 3-4 weeks of age (Jackson Laboratories, Bar Harbor, ME). Wild-type C3H/HeN (C3HnDNA:C3HmtDNA ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... all mice were given opposite-sex experience with novel female CBA/J mice (The Jackson Laboratory, Bar Harbor, ME) through multiple 10-minute interactions across the span of 2-3 days [11] ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Focal subjects consisted of seven-week-old male CBA/J mice (N = 23) (The Jackson Laboratory, Bar Harbor, ME). Mice were housed in a 14:10 light:dark cycle with food and water ad libitum ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 8 to 12-week-old male and female C57BL/6J mice were purchased from Jackson Laboratories (Bar Harbor, ME). Animals were acclimated to a temperature-controlled room with a 12-hour light/dark cycle ...
-
bioRxiv - Neuroscience 2024Quote: ... crossed with Ai162(TIT2L-GC6s-ICL-tTA2)-D mice (Jackson Lab Stock No: 031562), PV-Cre::APPswe/PS1dE9 (cross between B6;129P2-Pvalbtm1(cre)Arbr/J ...
-
bioRxiv - Developmental Biology 2020Quote: ... and subcutaneously injected into the hind leg of SCID mice (NOD.Cg-PrkdcscidI12rgtm1wj1/SzJ) (The Jackson Laboratory, Bar Harbor, ME, USA). Teratoma tissue was harvested eight weeks after injection and prepared for histological analysis by H&E staining ...
-
bioRxiv - Developmental Biology 2021Quote: Wildtype female (∼3-4 weeks old) C57BL/6J mice (Mus musculus) were ordered from Jackson Laboratories (Bar Harbor, ME, USA); wildtype male C57BL/6J mice were ordered or bred in-house from mice from Jackson Laboratories ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse zygotes were obtained by mating super ovulated B6C3F1/J females with B6C3F1/J males (Jackson Labs, Bar Harbor, ME). RNAs and ssODN were thawed and mixed just prior to injections for final concentrations of ...
-
bioRxiv - Neuroscience 2021Quote: Primary cultures of rat hippocampal neurons were prepared from P0-P1 Wistar rats (RjHan:WI; The Jackson Laboratory, Bar Harbor, ME) of both sexes according to (D’Este et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Cx3cr1-/- mice (Cx3cr1EGFP/EGFP; stock #005582) and C57Bl6/J (stock #000664) mice were obtained from Jackson Laboratories (Bar Harbor, ME). Heterozygous breeder pairs were set up for all experiments and wild-type (WT ...
-
bioRxiv - Neuroscience 2020Quote: The care and use of mice (2-6 months old; C57BL/6J; Jackson Laboratory, Bar Harbor, ME; Supplementary Table 4) followed all federal and institutional guidelines ...
-
bioRxiv - Neuroscience 2021Quote: Experiments were conducted using 8-12 week-old (20-30 g) female C57BL/6J mice (Jackson Laboratories, Bar Harbor, ME) that were group housed (4-5 mice/cage ...
-
bioRxiv - Microbiology 2020Quote: Six- to 12-week-old C57BL/6J male and female mice from barriers RB07 and RB16 (Jackson Laboratory, Jackson, ME) were used for all murine models of infection ...
-
bioRxiv - Cancer Biology 2020Quote: ... mixed with Matrigel and implanted into a subcutaneous flank of female NOD/SCID gamma (NSG, Jackson Laboratory, Bar Harbor, ME) mice to generate xenografts (26) ...
-
bioRxiv - Cell Biology 2021Quote: C57BL/6 mice and mdx (strain: C57BL/10ScSn-Dmdmdx/J) mice were purchased from Jackson Laboratories (Bar Harbor, ME, USA) and breeding colonies were maintained at the University of Houston animal resource facility ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The line was propagated by backcrossing N1768D/+ heterozygotes to C57BL/6J wild-type mice (The Jackson Laboratory, Bar Harbor, ME). Male N1768D/+ heterozygotes on a C57BL/6J background were subsequently backcrossed to C3HeB/FeJ female mice ...
-
bioRxiv - Immunology 2021Quote: ... Fearon (Cold Spring Harbor Laboratory)26 and were backcrossed onto the C57BL/6J background (The Jackson Laboratory, Bar Harbor, ME) for more than 11 generations ...
-
bioRxiv - Immunology 2021Quote: ... B6.Cg-Tg(TcraTcrb)425Cbn (OT-II) and C57BL/6-Il17atm1Bcgen (IL17a-GFP) mice (The Jackson Laboratory, Bar Harbor ME) were housed under specific pathogen-free conditions in animal facilities maintained by the Animal Resources Core (ARC ...
-
bioRxiv - Cancer Biology 2020Quote: ... and subcutaneously injected into the flanks of 8 week-old female NOD/SCID mice (The Jackson Laboratory, Bar Harbor, ME). After tumors reached a size of 200 mm3 mice were treated with vehicle (benzyl alcohol ...
-
bioRxiv - Neuroscience 2020Quote: ... EMX1-Cre (Stock #005628) and Ai14 Cre reporter allele (Stock # 007914) were obtained from Jackson Laboratories (Bar Harbor, ME, USA). Floxed NR2A and NR2B alleles were provided by the laboratory of Prof ...
-
bioRxiv - Cell Biology 2021Quote: ... Livers were isolated from gestational day 15-19 mouse fetuses from C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME) in accordance with South Dakota State University Institutional Animal Use and Care Committee ...
-
bioRxiv - Molecular Biology 2022Quote: ... AAVs were injected into the subretinal space of 28 day old Prph2rds/rds mice (#001979 Jackson Laboratory, Bar Harbor, ME). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... The 3xTg AD mouse model is based on a C57BL/6;129X1/SvJ;129S1/Sv (Jackson Laboratory, Bar Harbor, ME, USA) background ...
-
bioRxiv - Cancer Biology 2022Quote: ... NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(PGK1-KITLG*220)441Daw/SzJ mice (stock No: 017830) (The Jackson Laboratory, Bar-Harbor, ME, USA). NOD.Cg-Prkdcscid Il2rgtm1Wjl Tg(CMV-IL3,CSF2,KITLG)1Eav/MloySzJ mice (Stock No ...
-
bioRxiv - Microbiology 2022Quote: ... C3-/- mice in BALB/c background were generated from the C3-/-(C57BL/6) purchased from Jackson Laboratory (Bar Harbor, ME) as described in our previous study (Hart et al ...
-
bioRxiv - Immunology 2022Quote: ... and Acod1-deficient Acod1em1(IMPC)J/J mice (JAX stock #029340) were obtained from Jackson Laboratories (Bar Harbor, ME, USA). Mice were maintained under SPF conditions and killed in accordance with the German policies on animal welfare.
-
bioRxiv - Molecular Biology 2020Quote: All transgenic strains had been backcrossed at least ten generations onto a C57BL/6 background (Jackson Laboratories, Bar Harbor, ME). Rosa–creER ...
-
bioRxiv - Neuroscience 2020Quote: ... We used 6-11 weeks old heterozygous Gad2-IRES-Cre mice (Jax #010802, The Jackson Laboratory, Bar Harbor, ME, USA) of either sex ...
-
bioRxiv - Neuroscience 2021Quote: The following commercially available mouse lines were used: B6.129P2-Pvalbtm1(cre)Arbr/J (Jackson Laboratories stock 017320; Bar Harbor, ME) and B6.129S-Hcn1tm2Kndl/J (Jackson Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... C3−/− mice in BALB/c background were generated from the C3−/− (C57BL/6) purchased from Jackson Laboratory (Bar Harbor, ME) as described in our previous study (21) ...
-
Serotonin Modulates an Inhibitory Input to the Central Amygdala from the Ventral Periaqueductal GraybioRxiv - Neuroscience 2022Quote: ... Vgat-ires-Cre mice were bred in house from Vgat-ires-Cre x C57BL6/J (Jackson Laboratories, Bar Harbor, ME) pairings ...
-
bioRxiv - Cell Biology 2022Quote: ... Pancreatic islets were isolated from 8 to 12-week-old C57Bl/6J (Jackson Lab, Bar Harbor, ME, RRID: IMSR_JAX:000664) male mice by collagenase digestion (Roche Applied Science)21 ...
-
bioRxiv - Physiology 2020Quote: ... Apoe-/- (apolipoprotein E knockout) and P2rx7-/- (P2X purinoceptor 7 knockout) mice were obtained from Jackson Laboratories (Bar Harbor, ME, USA) and the wild-type C57BL/6NHsd mice from Envigo (Indianapolis ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Mouse colonies were maintained by breeding Ube3a deletion males (B6.129S7- Ube3atm1Alb/J; Jackson Laboratory, Bar Harbor, ME; Stock No. 016590) with congenic C57BL/6J (B6J ...
-
bioRxiv - Pathology 2021Quote: ... Hepatocyte-specific deletion of Pparγ gene noted PPARγ ΔHep were generated crossing Alb-CRE+/− (Jackson Laboratory, Ban Harbor, ME, USA) with Pparγ floxed mice noted PPARγfl/fl (a generous gift from Pr ...
-
bioRxiv - Immunology 2020Quote: Young (2 months) and Old (18-22 months) male C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, ME) and the National Institute on Aging colonies and housed in a specific-pathogen free facility at the University at Buffalo ...
-
bioRxiv - Neuroscience 2020Quote: ... The Shank3ΔC mice have a deletion of exon 21 that includes the Homer-binding domain (Jackson laboratory, Bar Harbor, ME) and were backcrossed to C57BL6/J mice ...
-
bioRxiv - Neuroscience 2021Quote: ... Hemizygous B6SJL.SOD1(G93A) transgenic mutant males were bread with B6SJL F1 females (obtained from the Jackson Laboratory, Bar Harbor, ME)(Leitner et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Gli1-CreER Rosa-tdTomato (Gli1ER/Td) mice were generated by breeding Gli1-CreER mice (Jackson Laboratory, Bar Harbor, ME USA) with Rosa-tdTomato mice (Jackson Laboratory) ...
-
bioRxiv - Immunology 2021Quote: C57BL/6 mice (Mus musculus, females, 6 to 8 weeks old) were purchased from Jackson Laboratory (Bar Harbor, ME, USA) and housed in microisolator units ...