Labshake search
Citations for The Jackson Laboratory :
51 - 100 of 220 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... that were bred in house from breeding pairs obtained from Jackson Laboratory (JAX stock # 033168).
-
bioRxiv - Genomics 2022Quote: ... GH receptor-intact male mice (C57Bl/6 strain from Jackson Labs, 10 wk old) were treated with AAV8-Null or AAV8-STAT5CA (0.75 x 1011 GC per mouse ...
-
bioRxiv - Developmental Biology 2023Quote: ... Female mice heterozygous for deletion of the leptin receptor (Hetdb) (Jackson Laboratory, stock #: 000697) were used as a model of high pre-pregnancy adiposity ...
-
bioRxiv - Immunology 2024Quote: ... male and female global Toll Like Receptor 2 knockout (TLR2KO; Jackson Labs; Tlr2tm1Kir/J)44,45 and male and female global Serum Amyloid A3 (SAA3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Original breeding pairs of Chat-Cre(B6;129S6-Chattm1(cre)Lowl/J) were obtained from Jackson Laboratory, (Maine ...
-
bioRxiv - Neuroscience 2021Quote: ... Mating pairs of wild-type C57BL/6J mice were purchased from Jackson Laboratories (Bar Harbor, ME). All mice had free access to rodent chow and water in a 12-hour dark-light cycle room.
-
bioRxiv - Physiology 2022Quote: ... A heterozygous APOE3 breeding pair (B6.Cg-Apoeem2(APOE*)Adiuj/J) was purchased from Jackson Laboratory, Bar Harbor ...
-
bioRxiv - Neuroscience 2024Quote: ... Breeding pairs consisted of C57BL6/J females (Jax 000664) and SOD1G93A males purchased from Jackson laboratories, where they were assessed for transgene copy number maintenance ...
-
bioRxiv - Immunology 2023Quote: ... C;129S4-Rag2tm1.1Flv- Il2rgtm1.1Flv/J (RAG2gc KO) and breeding pairs were originally purchased from Jackson Laboratory and bred under specific pathogen free conditions ...
-
bioRxiv - Neuroscience 2023Quote: Twitcher (twi) mice and wild-type (WT) littermates were obtained from heterozygous breeding pairs (Jackson Laboratory). Genotyping of Twitcher mice was based on the use of a PCR mismatched primer that creates a restriction site for EcoRV if the Galc allele possesses the mutation ...
-
bioRxiv - Bioengineering 2023Quote: ... Female NSG (NOD/SCID/IL2 receptor gamma chain knockout) mice were obtained from Jackson Laboratory. The animals were housed under a 12/12 hours light/dark cycle ...
-
bioRxiv - Immunology 2023Quote: Background strains for androgen receptor knockout were originally purchased from Jackson Laboratories (Bar Harbor, ME). Ksp-Cre × ARf/f mice were generated by crossing B6.129S1-Artm2.1Reb/J (#018450 ...
-
bioRxiv - Neuroscience 2020Quote: Male and female 3xTg-AD breeder pairs (#34830-JAX) were obtained from Jackson Laboratories (Bar Harbor, Maine) and were used to breed male and female 3xTg-AD mice for this experiment ...
-
bioRxiv - Genetics 2020Quote: ... B6J x D2J-F1 mice (15 breeder pairs) were purchased from Jackson Laboratory (JAX; Bar Harbor, ME) and were habituated in the colony for one week prior to breeding in-house to generate 128 B6J x D2J-F2 mice for experimental testing.
-
bioRxiv - Neuroscience 2022Quote: ... The transgenic mice were bred in-house after the breeding pairs were initially obtained from Jackson Laboratory. Additionally ...
-
bioRxiv - Cancer Biology 2024Quote: ... Alpha-synuclein KO mice (C57BL/6N- Sncatm1Mjff/J) were obtained from Jackson Laboratories (strain #016123). Homozygous alpha-synuclein KO mice were crossed with TG3 heterozygous mice and double heterozygote F1 mice were crossed to each other to generate F2 mice for analysis ...
-
bioRxiv - Cancer Biology 2021Quote: OT-I T cell receptor (TCR) transgenic mice were purchased from Jackson Laboratories (Bar Harbor, ME). Splenocytes were harvested and T cells were subsequently isolated from the mononuclear layer using Ficoll separation and directly used in co-culture assays ...
-
bioRxiv - Neuroscience 2023Quote: ... Homozygous mice for fractalkine receptor (Cx3cr1gfp/gfp; B6.129P-Cx3cr1tm1Litt/J) were also obtained from Jackson Laboratory. Part of Cx3cr1gfp/gfp mice was maintained either as homozygotes (Strain #005582 ...
-
bioRxiv - Physiology 2022Quote: ... The deletion was confirmed using forward primer: TCAGGGAGTCAGTCATTAACCA and reverse primer: CAATAAGACCTGGCACAAGGA according to the protocol detailed by Jackson Laboratories (https://www.jax.org/Protocol?stockNumber=027197&protocolID=19636) ...
-
bioRxiv - Physiology 2022Quote: ... Breeding pairs were originally purchased from The Jackson Laboratory (The Jackson Laboratory; Thy-1 YFP-16, Stock# 003709). Mice were bred from homozygous breeding pairs and were fed a standard laboratory diet ad libitum ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Breeding pairs of C57/B6 and Pparα-null (Pparα-/-) mice were obtained from Jackson Laboratory (Bar Harbor, ME). ATF4 liver conditional knockout mice (Atf4ΔHep ...
-
bioRxiv - Physiology 2022Quote: ... A homozygous APOE4 breeding pair (B6(SJL)-Apoetm1.1(APOE*4)Adiuj/J) was also purchased from Jackson Laboratory. Mice were fed a standard chow diet (Teklad 2018 ...
-
bioRxiv - Cancer Biology 2023Quote: ... NOD-SCID interleukin-2 receptor gamma null (NSG) mice were purchased from Jackson Laboratories (Bar Harbor, ME). For all studies involving NR-V04 and celastrol ...
-
bioRxiv - Genetics 2020Quote: ... Breeding pairs of spf-ash mice (B6EiC3Sn a/A-OTCSpf-Ash/J) were purchased from Jackson Laboratories (Cat# 001811) and housed in individually ventilated cages ...
-
bioRxiv - Immunology 2022Quote: ... Breeding pairs of B6.129S2-Tcratm1Mom/J (TCRα KO) and B6.SJL-PtprcaPepcb/BoyJ (CD45.1) mice were purchased from Jackson Laboratories. Congenic CD45.1 mice were backcrossed with CD43-/- mice (kindly provided by Pilar Alcaide ...
-
bioRxiv - Neuroscience 2022Quote: ... Male and female C57BL/6J (C57) mice were bred at Augustana University using breeding pairs obtained from Jackson Laboratories, Bar Harbor ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and rabbit anti-alpha tubulin (1:5000) and either goat anti-mouse HRP 1:20,000 (Jackson Labs) or goat anti-rabbit HRP 1:40,000 (Jackson Labs) ...
-
bioRxiv - Immunology 2023Quote: ... Rag1 KO-/- were generated by breeding 10 Male and 10 Female B6.129S7-Rag1 (homozygous for Rag1) breeding pairs from Jackson Laboratory. For immune characterization of the peripubertal DHT-induced PCOS mice ...
-
bioRxiv - Cell Biology 2023Quote: ... Breeding pairs of Ins1-cre (Thorens et al., 2015) (B6(Cg)-Ins1tm1.1(cre)Thor/J were purchased from Jackson laboratories) ...
-
bioRxiv - Immunology 2023Quote: ... MuMt- mutant mice were generated from 10 Male and 10 Female B6.129S2-Ighm (homozygous for Ighm) breeding pairs from Jackson Laboratory. No mice received further monthly implants.
-
bioRxiv - Bioengineering 2023Quote: ... A breeding pair of transgenic B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J (JAX #007676, Jackson lab, ME)64 ...
-
bioRxiv - Biophysics 2023Quote: ... A breeding pair of transgenic B6.129(Cg)-Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)Luo/J (JAX #007676, Jackson lab, ME), hereafter referred to as mTmG ...
-
bioRxiv - Immunology 2022Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for CD4cre ...
-
bioRxiv - Immunology 2021Quote: ... Standard PCR reaction conditions and primer sequences from Jackson Laboratories were used for Eomes ...
-
bioRxiv - Neuroscience 2022Quote: ... Genotypes were confirmed using primer sets recommended by Jackson Laboratory and Sinha lab.
-
bioRxiv - Neuroscience 2023Quote: ... The recommended primers and PCR protocols designed by Jackson laboratories were used to verify the transgenes (primers purchased from Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were genotyped with primer sets suggested by Jackson labs.
-
bioRxiv - Physiology 2024Quote: ... according to manufacturer instructions with primers suggested by Jackson Laboratories. The PCR reaction was run on an ethidium bromide agarose gel ...
-
bioRxiv - Bioengineering 2024Quote: ... T cell antigen receptor-transgenic OT-I mice (C57BL/6-Tg(TcraTcrb)1100Mjb/J) were purchased from Jackson Laboratory. The Hepa1-6 and 3T3 cell lines were purchased from ATCC ...
-
bioRxiv - Biophysics 2020Quote: ... Mice were obtained from our breeding colonies from breeding pairs that were established and are refreshed every 6 months from Jackson Labs, JAX (Bar Harbor ...
-
bioRxiv - Bioengineering 2021Quote: ... and OT1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J) transgenic mice were bred in house using breeding pairs purchased from Jackson Lab. C57BL/6 and BALB/c mice for tumor studies were purchased from Jackson Lab ...
-
bioRxiv - Microbiology 2020Quote: ... MyD88-deficient mice (MyD88-/-) with C57BL/6J genetic background were obtained from a local breeding colony (breeding pairs were purchased from Jackson Laboratories). Animals were housed in the animal facility of the University Hospital Tübingen under specific-pathogen-free (SPF ...
-
bioRxiv - Bioengineering 2021Quote: ... and OT-1 (C57BL/6-Tg(TcraTcrb)1100Mjb/J) transgenic mice were bred in house using breeding pairs purchased from Jackson Lab. C57BL/6 for PR8 viral infections were purchased from Jackson Lab ...
-
bioRxiv - Neuroscience 2022Quote: Male and female BTBR T+Itpr3tf/J (BTBR) mice were bred at Augustana University using breeding pairs obtained from Jackson Laboratories, Bar Harbor ...
-
bioRxiv - Systems Biology 2023Quote: ... established from breeding pairs consisting of wild type (WT) male (003647) and Ts65Dn females (005252, the Jackson Laboratory, Bar Harbor, USA). The date of conception (E0 ...
-
bioRxiv - Neuroscience 2023Quote: ... Breeding pairs of A53Tsyn mice raised on a C57BL6 background and C57BL6 mice were purchased from Jackson Laboratory (Bar Harbor, ME). Animals were housed in a climate-controlled facility with a 12-h light/12-h dark cycle ...
-
bioRxiv - Neuroscience 2023Quote: ... Mice were 8-9 week old male and female C57BL/6 mice bred at PSUCOM or UMSOM with original breeding pairs obtained from Jackson Labs. All mice were pair housed in corn-cob bedding ...
-
bioRxiv - Immunology 2024Quote: ... 5-week-old male low-density lipoprotein receptor knockout (LDLRKO) mice were originally purchased from Jackson Laboratories (Bar Harbor, ME) and propagated further in our colony ...
-
bioRxiv - Cancer Biology 2023Quote: Mouse back injections were carried out in 9-week-old NOD/SCID male mice (with IL-2 receptor γ chain null mutation, NOD.Cg-Prkdcscid Il2rψtm1Wjl/SzJ, (the Jackson Laboratory). 2.5 x 105 RFP-SCC13 tumor cells ...
-
bioRxiv - Cell Biology 2023Quote: Foxl1-Cre mice50 were crossed with Rosa-inducible diphtheria toxin receptor (iDTR)51 mice (Jackson Laboratories Bar Harbor, ME #007900) and or Rosa-membrane-targeted dimer tomato protein (mT ...