Labshake search
Citations for Sino Biological :
201 - 235 of 235 citations for PVRIG Mouse HEK 293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse Pygo2 and Kit were subcloned from the original vectors (OriGene Technologies, MR206368; Sino Biological, MG50530-CH) into the pMSCV-puro retroviral backbone (Addgene ...
-
bioRxiv - Microbiology 2020Quote: ... incubated with mouse anti-SARS-CoV-2 nucleocapsid protein (1:1000, Sino Biological, Beijing, China; 40145-MM05) overnight in blocking buffer ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCoV) spike neutralizing mouse monoclonal antibody (Cat#40591-MM43, Sino Biological, Wayne, PA) were used as positive controls in the assay ...
-
bioRxiv - Immunology 2023Quote: ... 50 µL of the primary antibody (SARS-CoV-2 Nucleocapsid Antibody, Mouse Mab, Sino Biologicals, #40143-MM08) diluted 1:1000 in 1.25% BSA/PBS was added to each well ...
-
bioRxiv - Microbiology 2021Quote: ... Primary Ab used for this labelling were: mouse anti-SARS COV2 nuceloprotein (Sino Biological, 40143-MM05, 1:100) and rabbit anti-GFAP (GeneTex ...
-
bioRxiv - Neuroscience 2020Quote: ... were coated with 100 µl of 1 µg/ml of recombinant mouse TfR1 (rm-TfR1-ECD; Sino Biological), rh-TfR1-ECD ...
-
bioRxiv - Neuroscience 2020Quote: ... were coated with 100 µl of 1 µg/ml of recombinant mouse and human TfR1-ECD (Sino Biological) and human serum albumin (HSA ...
-
bioRxiv - Microbiology 2020Quote: ... Viral NP and HA proteins were detected using mouse anti-NP (catalog no. 11675-MM03; Sino Biological, Beijing, China) and rabbit anti-HA2 (catalog no ...
-
bioRxiv - Immunology 2021Quote: ... sections were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:4,000 and incubated at room temperature for 45 min ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence staining was conducted using the SARS-CoV-2 nucleoprotein mouse monoclonal antibody (1:500; Sino Biological #40143-MM05), Alexa-Fluor Plus 488 anti-mouse antibody (1:1,000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Chi3l1-/- mice treated with APAP were immediately injected (i.p.) with either PBS (100μl) or recombinant human Chi3l1 (rhChi3l1, 1μg/mouse in 100μl, Sino Biological 11227-H08H). After 3h ...
-
bioRxiv - Cell Biology 2024Quote: ... a mouse monoclonal antibody against the SARS-CoV-2 nucleocapsid protein (SARS-CoV-2-N, Sino Biological, 40143-MM05) was used5 ...
-
bioRxiv - Immunology 2022Quote: ... were coated with 15 μg/ml of anti-IgM and/or anti-IgG with or without 0.5 μg/ml of mouse histidine-tagged ICAM-1 (Sino Biological) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... and incubated with 1:1000 mouse antibody specific for SARS-CoV-2 nucleocapsid protein (Sino Biological, Beijing, China 40143-MM05) overnight at 4°C in blocking buffer consisting of 2% FBS and 2% BSA ...
-
bioRxiv - Immunology 2020Quote: ... Primary antibodies used were against spike protein (S) (Mouse monoclonal, Gene tex (1A9)) or nucleoprotein (N) (Rabbit monoclonal, Sino Biological). Following 3x PBS washes ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 and SARS-CoV were stained with mouse-anti-SARS-CoV nucleoprotein (40143-MM05, 1:400, Sino Biological) or rabbit-anti-SARS-CoV nucleoprotein (40143-T62 ...
-
bioRxiv - Immunology 2023Quote: Mouse primary OPCs were treated with neutralizing antibody against TNFR2(anti-TNFR2; Cat#50128-RN204,RRID:AB_2860178,Sino Biological,6ug/mL) for 1 hour prior to exposure to pro-inflammatory cytokines ...
-
bioRxiv - Microbiology 2021Quote: ... The cDNA of human CD47 and mouse CD47 with an HA-tag at the C-terminal were purchased from Sino Biological and Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Presence of virus replication in each well was assessed by visual examination of cytopathic effect along with antibody staining for N protein antigen (mouse monoclonal antibody 40143-MM08, Sino Biological) with fluorescent secondary antibody detection ...
-
bioRxiv - Immunology 2020Quote: ... The plate was washed for 3 times then incubated with mouse sera and SARS-CoV-2 Spike antibody (Sino Biological, China) for 2 hours at 37 °C ...
-
Efficacy of recombinant NP-M1 and NP-M1-CRT DNA vaccines against Influenza A viruses in mice C57/BL6bioRxiv - Molecular Biology 2021Quote: ... and then membrane incubated with mouse anti-influenza A virus NP protein monoclonal Ab (Sino biological Company, China; 1: 10,000, 1 h) or mouse anti-influenza polyclonal anti-body (1 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were incubated for 2 h at room temperature with mouse anti-MERS-CoV N IgGs (1:000 dilution, Sino Biological, China), followed by 1 h of incubation with Alexa Fluor 488-labeled goat anti-mouse IgG (2.5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and tracheobronchial lymph node were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at room temperature for forty five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...