Labshake search
Citations for Sino Biological :
151 - 200 of 411 citations for Mouse Sulfotransferase family cytosolic 2B member 1 SULT2B1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 spike specific antibody was generated by immunized Balb/c mouse with SARS-CoV-2 spike protein (RBD, Fc Tag, 40592-V05H, Sino Biological inc). MAbs against SARS-CoV-2 RBD were produced using hybridoma technology and were characterized by pseudotyped virus assay.
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Cell Biology 2022Quote: ... TNFα (R023, Sino Biological; 1:100) and IL-6 (MP5-20F3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and PSGL-1-Fc (Sino Biological) were obtained from the described sources.
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-SARS-CoV-2 nucleocapsid (WB 1:2500; IF 1:500; Sino Biological Inc., 40143-R001), mouse APC-conjugated antibody directed against dsRNA J2 (IF 1:200 ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and tracheobronchial lymph node were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at room temperature for forty five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Adipsin (Sino Biological, 1 μg/mL) and C3aR1 inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-LAMP1 (1:200, Sino Biological), rabbit anti-VAP-A (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Sino Biological; VG40150-CF)(Genbank AAP13567.1) ...
-
bioRxiv - Immunology 2024Quote: ... EG.5.1 and JN.1 (Sino Biological). ELISA plates (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 1 hour at RT with 1:1,000 of anti-spike antibody (Rabbit MAb, Sino Biological, Beijing, CN) diluted in blocking buffer ...
-
bioRxiv - Immunology 2024Quote: ... The plates were incubated with biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological, 1 μg/ml) for 2 h and Streptavidin-AP Conjugate from Invitrogen (1.5 μg/ml ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 1:5000 dilution or 1:5000 Rabbit Polyclonal anti-SARS-CoV2 RBD (Cat# 40592-T62 Sino Biological, Chesterbrook, PA), in Haycock blocking solution ...
-
bioRxiv - Biophysics 2021Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng ml-1 ...
-
bioRxiv - Microbiology 2020Quote: ... pSARS-CoV-1 was purchased from Sino Biologicals. pCAGGS expressing SARS-CoV-2 RBD was obtained from BEI Resources (cat#NR-52309) ...
-
bioRxiv - Biophysics 2020Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng mL−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 100 U ml-1 Supernuclease (Sino Biological) and then lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-Rnd3 (1:1000; Sino Biological; 101056-T32). Secondary antibodies include Alexa Fluor 568 anti-mouse (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... 2019-nCoV WA-1 (Sino Biological 40592-V08B), Delta variant B.1.617.2 (Sino Biological 40592-V08H90) ...
-
bioRxiv - Immunology 2021Quote: ... human ICAM-1-His (Sino Biological, #10346-H08H), and streptavidin (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... RBD (K417N/ WT/ Omicron BA.1) (Sino Biologicals) or streptavidin (catalogue #434302 ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.1 (Sino Biological, cat. 40589-V08H26), Omicron BA.2 (Sino Biological ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were treated with methanol 0.6% H2O2 and stained for 1 h with a 1:3000 dilution of 40143-R019 rabbit mAb to SARS-CoV-2 nucleocapsid protein (Sino Biological). A 1:3000 dilution of sheep anti-rabbit HRP conjugate (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... The supernatants of Expi293™ cells transfected with pAd/SARS-CoV-2-S1SA was diluted 1:40 in PBS-T with 1% BSA and along with standard control protein 40591-V08H (rS1H, Sino Biological) or purified rSARS-CoV-2S1Beta were incubated overnight at 4°C ...
-
bioRxiv - Neuroscience 2022Quote: ... All membranes were blocked with 5% BSA in TBST for 1 hour at room temperature and subsequently incubated with rabbit anti-FcγRI (1:1000, Cat: 80016-R015, Sino Biological Inc.), rabbit anti-FcRγ (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng ml-1 ...
-
bioRxiv - Biophysics 2020Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng mL−1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Nucleoprotein (N; Sino Biological #40143-R019, 1:5000) overnight ...
-
bioRxiv - Immunology 2022Quote: ... RBD protein 1 μg/mL (Sino Biological, Beijing, China), or NTD protein 2 μg/mL (Moderna ...
-
bioRxiv - Microbiology 2022Quote: ... or anti-N antibody (1:5,000 dilution; Sino Biological). The immune complexes were visualized with SuperSignal West Femto substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: Sections were covered with rabbit polyclonal anti-SARS-CoV S antibody diluted at 1:250 (Sino Biologicals, #40150-T62-COV2, Supplemental Table 1) overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 000 sorted CXCR4low MKs or CXCR4high MKs were added in the upper inserts and placed onto macrophages chambers for additional 16 hours incubation without or with 2 μg ml−1 TNFα neutralizing antibody (R023, Sino Biological; 1:100) or 2 μg ml−1 IL-6 neutralizing antibody (MP5-20F3 ...
-
bioRxiv - Immunology 2021Quote: ... before being mixed 1:1 with medium (RPMI 1640 supplemented with 1% FBS and 1% penicillin streptomycin solution (Biological Industries) containing 20 μg/mL N (Sino Biological, Beijing, China) or S1 proteins ...
-
bioRxiv - Neuroscience 2022Quote: ... and -Spike Subunit 1 Antibody (Monoclonal Rabbit Anti-Human, Citrate Buffer HIER, dilution 1:100, Clone 007, Sino Biological, Code Number: 40150-R007) immunostainings were employed to evaluate viral antigens within the tissue ...
-
bioRxiv - Microbiology 2021Quote: ... against N protein from Sino Biological (#40143-R019, 1:1000), and against calnexin from Enzo (#ADI-SPA-860-F ...
-
bioRxiv - Microbiology 2021Quote: ... TMPRSS2 (Rabbit Polyclonal, 1:50, Sino biological, Cat# 204314-T08), SARS-CoV-2 Nucleocapsid (Rabbit Polyclonal ...
-
bioRxiv - Neuroscience 2021Quote: ... Rabbit: SARS-CoV-2 (Sino Biological, 40143-R001, 1:200), Pax6 (Biolegend ...
-
bioRxiv - Immunology 2020Quote: ... or 1-10 μg of Spike RBD protein (Sino Biological, Cat ...
-
bioRxiv - Microbiology 2022Quote: ... SARS-CoV-2 Nucleocapsid (Sino Biological, #40143-R019, 1:10000), STAT1 (Cell Signaling ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg/ml N protein (Sino Biological, PA, USA) onto ELISA plates (Corning ...
-
bioRxiv - Immunology 2022Quote: ... or rabbit anti-SARS-CoV nucleoprotein (1:3,000) (Sino Biological) was added and incubated overnight at 4°C as primary antibody ...