Labshake search
Citations for Sino Biological :
601 - 650 of 816 citations for Mouse Macrophage expressed gene 1 protein MPEG1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Cell Biology 2022Quote: ... TNFα (R023, Sino Biological; 1:100) and IL-6 (MP5-20F3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and PSGL-1-Fc (Sino Biological) were obtained from the described sources.
-
bioRxiv - Neuroscience 2019Quote: ... CSF and plasma sTREM2 concentrations were calculated using the standard curve generated for each plate using recombinant human TREM2 protein (Sino Biological, Wayne, PA). A dedicated CSF and plasma sample was loaded onto all plates and used to normalize values ...
-
bioRxiv - Immunology 2021Quote: ... Cells infected with MV-014-212 were stained with primary rabbit anti-SARS-CoV-2 spike protein polyclonal antisera (Sino Biologicals, Beijing, China). The plates were incubated for 1 hour at room temperature with constant rocking ...
-
bioRxiv - Bioengineering 2021Quote: ... was incubated with 5 ng/µl of SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant Protein (Sino Biological #40589-V08B1) in phosphate buffer (pH 6.0) ...
-
bioRxiv - Microbiology 2020Quote: ... For the detection of SARS-CoV-2 spike protein a rabbit polyclonal anti-SARS-CoV-2 spike S2 antibody (Sino Biological #40590-T62) was used.
-
bioRxiv - Immunology 2021Quote: ... Potency was assessed using a cell-based immunosorbent assay to quantify infection by detecting the SARS-CoV-2 nucleoprotein using a specific antibody raised against this protein (Sino Biological, Wayne, PA). The secondary antibody (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... with 5×105 TCID50 of recombinant MeV-derived vaccine virus in 200 μl volume or subcutaneously (s.c.) with 10 μg recombinant SARS-CoV-2 S protein (Sino Biological Europe, Eschborn, Germany) adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2% ...
-
bioRxiv - Immunology 2022Quote: ... pre-incubated beads were incubated a second time with 2 µg of a recombinant human DC-SIGN protein with a human Fc tag (Sino Biological, Köln, Germany) for 1 h at 4°C with agitation ...
-
bioRxiv - Microbiology 2021Quote: Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep ...
-
bioRxiv - Immunology 2023Quote: ... vaccines were formulated in 100 μL of PBS 1X and contained a 10 µg antigen dose of spike S1+S2 ECD (R683A, R685A, F817P, A892P, A899P, A942P, K986P, V987P)-His Recombinant Protein (Sino Biological 40589-V08H4) and a 20 µg 30% CpG-NPs adjuvant dose ...
-
bioRxiv - Biochemistry 2021Quote: ... rabbit anti-SARS-CoV-2 nucleocapsid (WB 1:2500; IF 1:500; Sino Biological Inc., 40143-R001), mouse APC-conjugated antibody directed against dsRNA J2 (IF 1:200 ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg of recombinant SARS-CoV-2 (2019-nCoV) spike S1 protein (Cat: 40591-V08H and 40591-V08H10, Sino Biological, endotoxin level: <0.001U/μg) was used per dose ...
-
bioRxiv - Genetics 2020Quote: ... Loaded sensors were dipped into recombinant SARS-Cov-2 His-tagged Spike protein (D614 or D614G, Sino Biological, Cat # 40591-V08H and 40591-V08H3).
-
bioRxiv - Immunology 2020Quote: ... and ADI-56046) were subject to two rounds of selection for binding to a recombinant SARS-CoV-2 S1 protein (Sino Biological, Cat # 40591-V08H). Induced yeast libraries covering at least 10-fold of their respective diversities were incubated with 10 or 1 nM biotinylated SARS-CoV-2 S1 protein under equilibrium conditions ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with an anti-SARS-CoV/SARS-COV-2 nucleocapsid (N) protein rabbit monoclonal antibody (#40143-R001, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at RT for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; S2, Invitrogen #PA1-41165; RBD, Sino Biological #40592-MP01) then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG (Bethyl ...
-
bioRxiv - Immunology 2020Quote: ... RBD219-N1C1 was detected using a rabbit monoclonal antibody against the SARS-CoV-2 Spike S1 protein (Sino Biological, Beijing, China; Cat#: 40150-R007) and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 4% PFA and were incubated with either a polyclonal antibody against the SARS-CoV-2 RBD protein (Sino Biological, Cat#40592-T62) or a monoclonal antibody against the SARS-CoV-2 S1 protein (MyBioSource ...
-
bioRxiv - Bioengineering 2023Quote: ... The sample solutions were prepared by spiking biotinylated SARS-CoV-2 N protein rabbit monoclonal antibody (no. 40143-R004-B; Sino Biological, Inc.; Beijing, China) in buffer solution (0.1% BSA and 0.05% Tween 20 in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Adipsin (Sino Biological, 1 μg/mL) and C3aR1 inhibitor ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-LAMP1 (1:200, Sino Biological), rabbit anti-VAP-A (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-1 (Sino Biological; VG40150-CF)(Genbank AAP13567.1) ...
-
bioRxiv - Immunology 2024Quote: ... EG.5.1 and JN.1 (Sino Biological). ELISA plates (Corning ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2020Quote: ... China) were coated with 2 μg/mL (50μL/well) SARS-CoV-2 Spike Protein (S1 Subunit, His tag) (Sino Biological, China, cat no:40591-V08H) in carbonate bicarbonate buffer pH9.6 and the plates were incubated at 4°C overnight ...
-
bioRxiv - Immunology 2023Quote: ... Paraffin blocks containing the left lung lobe were sectioned at approximately 4 microns and stained using hematoxylin and eosin (H&E) or immunostained using a rabbit monoclonal antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; cat. no. 40588-R002) and rabbit polyclonal antibodies against CD-3 protein (Dako ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated for 1 hour at RT with 1:1,000 of anti-spike antibody (Rabbit MAb, Sino Biological, Beijing, CN) diluted in blocking buffer ...
-
bioRxiv - Bioengineering 2023Quote: Nectagen’s nanoCLAMP phage display library NL-21 was panned as described (Suderman et al. 2017) against SARS CoV 2 Spike protein RBD (Sino Biologicals, S1RBD-Fc, cat#40592-VO2H) for rounds 1 and 2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... at 1:5000 dilution or 1:5000 Rabbit Polyclonal anti-SARS-CoV2 RBD (Cat# 40592-T62 Sino Biological, Chesterbrook, PA), in Haycock blocking solution ...
-
bioRxiv - Biophysics 2021Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng ml-1 ...
-
bioRxiv - Microbiology 2020Quote: ... pSARS-CoV-1 was purchased from Sino Biologicals. pCAGGS expressing SARS-CoV-2 RBD was obtained from BEI Resources (cat#NR-52309) ...
-
bioRxiv - Biophysics 2020Quote: ... His10-tag ICAM-1 (50440-M08H, Sino Biological) (270 ng mL−1 ...
-
bioRxiv - Biochemistry 2020Quote: ... and 100 U ml-1 Supernuclease (Sino Biological) and then lysed by sonication ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-Rnd3 (1:1000; Sino Biological; 101056-T32). Secondary antibodies include Alexa Fluor 568 anti-mouse (1:500 ...
-
bioRxiv - Immunology 2022Quote: ... 2019-nCoV WA-1 (Sino Biological 40592-V08B), Delta variant B.1.617.2 (Sino Biological 40592-V08H90) ...
-
bioRxiv - Immunology 2021Quote: ... human ICAM-1-His (Sino Biological, #10346-H08H), and streptavidin (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... RBD (K417N/ WT/ Omicron BA.1) (Sino Biologicals) or streptavidin (catalogue #434302 ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.1 (Sino Biological, cat. 40589-V08H26), Omicron BA.2 (Sino Biological ...
-
bioRxiv - Neuroscience 2022Quote: ... All membranes were blocked with 5% BSA in TBST for 1 hour at room temperature and subsequently incubated with rabbit anti-FcγRI (1:1000, Cat: 80016-R015, Sino Biological Inc.), rabbit anti-FcRγ (1:500 ...
-
bioRxiv - Biophysics 2021Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng ml-1 ...
-
bioRxiv - Biophysics 2020Quote: ... and His10-tag B7-1 (50446-M08H, Sino Biological) (130 ng mL−1 ...