Labshake search
Citations for Sino Biological :
151 - 171 of 171 citations for Mouse Leucine Rich Pentatricopeptide Repeat Containing LRPPRC ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Transfected HEK293T cells were stained with Fixable Viability Dye (eBioscience) and incubated with mouse Fc-tagged recombinant human ACE-2 (Sino Biological). A secondary donkey anti-mouse antibody conjugated with AF647 was used for detection of surface expression ...
-
bioRxiv - Immunology 2023Quote: Memory B cell culture supernatants were diluted in PBS and mixed with SARS-CoV-2 RBD mouse Fc-tagged antigen (Sino Biological, 40592-V05H ...
-
bioRxiv - Microbiology 2022Quote: ... S1 and S1+S2 (ECD) antibody titer assay kits (Sino Biological, Cat No ...
-
Efficacy of recombinant NP-M1 and NP-M1-CRT DNA vaccines against Influenza A viruses in mice C57/BL6bioRxiv - Molecular Biology 2021Quote: ... and then membrane incubated with mouse anti-influenza A virus NP protein monoclonal Ab (Sino biological Company, China; 1: 10,000, 1 h) or mouse anti-influenza polyclonal anti-body (1 ...
-
bioRxiv - Microbiology 2020Quote: ... cells were incubated for 2 h at room temperature with mouse anti-MERS-CoV N IgGs (1:000 dilution, Sino Biological, China), followed by 1 h of incubation with Alexa Fluor 488-labeled goat anti-mouse IgG (2.5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 spike specific antibody was generated by immunized Balb/c mouse with SARS-CoV-2 spike protein (RBD, Fc Tag, 40592-V05H, Sino Biological inc). MAbs against SARS-CoV-2 RBD were produced using hybridoma technology and were characterized by pseudotyped virus assay.
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and tracheobronchial lymph node were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at room temperature for forty five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2024Quote: ... Sections of the head were prepared to expose different regions of the nasal cavity and were stained with hematoxylin-eosin or an immunohistochemistry (IHC) staining kit using a SARS-CoV-2 spike RBD-specific antibody (Sino Biological). The damage score of each section was defined as 0 ...