Labshake search
Citations for Sino Biological :
451 - 500 of 619 citations for Mouse Anti Rift Valley Fever Virus Nucleoprotein Antibody DE1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:200), or anti-HA (H3663 ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2022Quote: ... immunohistochemistry with a monoclonal antibody detecting SARS-CoV/SARS-CoV-2 nucleocapsid (Sino Biological 40143-MM05) was performed on FFPE tissue sections ...
-
bioRxiv - Immunology 2020Quote: ... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological Inc.) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...
-
bioRxiv - Microbiology 2021Quote: ... a monoclonal antibody directed against the spike protein of SARS-CoV-2 (1:1,500, Sino Biological) was detected with a peroxidase-conjugated anti-rabbit secondary antibody (1:1,000 ...
-
bioRxiv - Immunology 2020Quote: ... and then incubated with the antibody against CD14 (1:200 dilution, 10073-RP0, Sino Biological, China) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... for MVA/S and rabbit SARS-CoV-2 RBD polyclonal antibody (Cat# 40592-T62, Sino Biological) for MVA/S1 diluted 1:2500 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit polyclonal against SARS-CoV-2 N protein antibody was purchased from Sino Biological (Beijing, China). Alexa Fluor 488-conjugated goat anti-mouse IgG ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody to SARS-CoV-2 spike subunit 1 (Sino Biological, Beijing, Cat. No. 40589-T62), was diluted 1:25 in blocking solution and grids were transferred to drops of primary antibody for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with a rabbit (2019-nCoV) S1 antibody (1:50; Sino Biological, Duesseldorf, Germany) and then incubated for 1 hour at 37°C with secondary goat anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Immunology 2021Quote: ... an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc, Beijing, China) was diluted in iBind solution (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-SARS-CoV-2 spike pAb (Sino Biological, 40592-T62), or anti-hCoV HKU1 spike monoclonal Ab (mAb ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cells were incubated with anti-Spike protein Rab (Sino Biological) at 1:1000 in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2022Quote: ... Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: Antibody was tested by indirect ELISA with the SARS-CoV-2 RBD protein (Sino Biological Inc., China) and peroxidase conjugated goat anti-cat IgG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies Nucleocaspid protein SARS-CoV-2 (1:200, 40143-MM05, Sino Biological) and cardiac troponin T (1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Immunology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral nucleocapsid was stained with rabbit anti-NP (1:500; Sino biological), ciliated cells were stained with anti-AcTub (1:100 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS and stained with rabbit anti-nucleocapsid (Sino biological; 1:2000) in PBS containing 0.1% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h ...
-
bioRxiv - Microbiology 2019Quote: ... S protein was detected using the MERS-CoV S rabbit polyclonal antibody (Sino Biological, Cat No: 40069-RP01) as the primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...