Labshake search
Citations for Sino Biological :
451 - 500 of 610 citations for Mouse Anti Respiratory Syncytial Virus Antibody RV12 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2022Quote: ... Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: Antibody was tested by indirect ELISA with the SARS-CoV-2 RBD protein (Sino Biological Inc., China) and peroxidase conjugated goat anti-cat IgG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies Nucleocaspid protein SARS-CoV-2 (1:200, 40143-MM05, Sino Biological) and cardiac troponin T (1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Immunology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral nucleocapsid was stained with rabbit anti-NP (1:500; Sino biological), ciliated cells were stained with anti-AcTub (1:100 ...
-
bioRxiv - Microbiology 2020Quote: ... or rabbit-anti-SARS-CoV nucleoprotein (40143-T62, 1:400, Sino biological). Tight junctions were stained using mouse-anti-ZO1 (ZO1-1A12 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS and stained with rabbit anti-nucleocapsid (Sino biological; 1:2000) in PBS containing 0.1% BSA ...
-
bioRxiv - Microbiology 2020Quote: ... Positive control for the nucleocapsid ELISA was SARS-CoV nucleoprotein rabbit monoclonal antibody (Sino Biological Inc, Beijing, China). Negative controls were reagent grade human sera (compared to Mab CR3022) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primary antibodies were used to stain the SARS-CoV-2 Nucleoprotein (N; Sino Biological #40143-R019, 1:8000) and Spike protein (S ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h ...
-
bioRxiv - Microbiology 2019Quote: ... S protein was detected using the MERS-CoV S rabbit polyclonal antibody (Sino Biological, Cat No: 40069-RP01) as the primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 were obtained from Sino Biological (Wayne ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of SARS-CoV-2 Spike antigen rabbit SARS-CoV Spike S1 antibody (40150-RP01, Sino Biological) and rabbit SARS-CoV Spike primary antibody (40150-T62-COV2 ...
-
bioRxiv - Biochemistry 2019Quote: ... the PVDF membrane was incubated the primary antibodies against Tf (1:2000, 11019-RP02, Sino Biological Inc., China) at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... Fixed and permeabilized cells were first stained with a primary antibody recognizing SARS-CoV nucleocapsid protein (Sino Biological), followed by secondary antibody staining with AlexaFluor 488-conjugated goat anti-rabbit antibody ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 N (1:1000 dilution, SARS-CoV-2 Nucleocapsid Antibody, Rabbit MAb, #40143-R019, Sino Biological), and GAPDH (1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 2 uG of each antibody was separately cross-linked to 2 uG of the Spike protein (Sino Biological Inc ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibody incubation was conducted for 3 hours at room temperature (1:2,000 α-N protein, Sino Biological 40143-R001 ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 nucleoprotein was detected by immunohistochemistry (IHC) using the rabbit monoclonal antibody (40143-R019, Sino Biological) at a 1:15000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were incubated with anti-S protein Rab (Sino Biological, PA, USA) at 1:1000 in the blocking solution overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SARS-Cov-2 spike S2 (Sino Biological #40590-T62, 1:1000), rabbit anti-β-actin (proteintech #20536-1-AP ...
-
bioRxiv - Bioengineering 2022Quote: ... or anti-hCoV HKU1 spike monoclonal Ab (mAb) (40021-MM07-100, Sino Biological) diluted 1:1000 in TBS with 0.1% Tween 20.
-
bioRxiv - Pathology 2022Quote: ... Rabbit anti-SARS-CoV-2 Spike S (1:200, Sino Biological, 40150-R007), Goat anti-ACE2 (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... Foci were stained with 50μl/well rabbit anti-nucleocapsid (Sino Biological, 40588-T62) diluted 1:1000 in 0.2% (w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound phage were detected by incubation with anti-M13-HRP conjugate (Sino Biological)(1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-HA murine mAb (Cat. No. 100028-MM10) was purchased from Sino Biologicals US Inc ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to PVDF membranes and immunoblotted with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...
-
bioRxiv - Neuroscience 2022Quote: ... such as rabbit anti-FcγRI (1:500, Cat: 80016-R015, Sino Biological Inc.), goat anti-FcRγ (1:100 ...
-
bioRxiv - Systems Biology 2023Quote: ... blocked with 5 % BSA stained with primary anti-NP (Sino Biological 40143-R001), and secondary goat anti-rabbit IgG conjugated to Alexa Fluor 488 (Thermo Fisher Scientific A-11034) ...
-
bioRxiv - Immunology 2023Quote: ... Keytruda-biosimilar (anti-PD1(MK)-IgG4) was purchased from Sino Biological (Beijing, China). B7-H1-Fc (PD-L1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rabbit polyclonal anti-SARS-CoV-2 nucleoprotein N protein (40068-RP01; Sino Biological) and anti-actin (L00003 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed and incubated in primary conjugated antibodies (EZH2, BD Bioscience; CD133, Miltenyi; CD15, Biolegend; Sox2, Sino Biological Inc. ...