Labshake search
Citations for Sino Biological :
251 - 300 of 447 citations for Mouse Anti Nipah Virus Glycoprotein G AE6 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Immunology 2020Quote: ... anti-SARS-CoV-1 N rabbit monoclonal antibody (40143-R001, Sino Biological), and anti-vaccinia rabbit polyclonal antibody (9503-2057 ...
-
bioRxiv - Molecular Biology 2019Quote: ... An anti-Tf antibody (1:2000, 11019-RP02, Sino Biological Inc, China) was used in the immunoreactivity ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... we used rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and goat anti-rabbit HRP- conjugated secondary antibody (Jackson ImmunoResearch) ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-SARS-CoV-2 N protein antibody was purchased from Sino Biological Inc ...
-
bioRxiv - Immunology 2022Quote: ... Anti-spike RBD antibody (clone MM57) obtained from Sino Biologicals (Cat#40592). FITC-conjugated goat secondary antibody against mouse IgG/IgM was purchased from BD Pharmingen (Cat# 555988) ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral nucleocapsid was stained with rabbit anti-NP (1:500; Sino biological), ciliated cells were stained with anti-AcTub (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... Anti‐SARS‐CoV‐2 N protein antibody was purchased from Sino Biological Inc (Beijing ...
-
bioRxiv - Immunology 2022Quote: ... anti-SARS-CoV-2 nucleocapsid antibody (2µg/µl, Sino Biological, 40143-R001) was used to probe NP expression ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-SARS-CoV-2 N protein antibody was purchased from Sino Biological Inc ...
-
bioRxiv - Microbiology 2020Quote: ... or rabbit-anti-SARS-CoV nucleoprotein (40143-T62, 1:400, Sino biological). Tight junctions were stained using mouse-anti-ZO1 (ZO1-1A12 ...
-
bioRxiv - Microbiology 2021Quote: ... followed by treatment with a murine anti-nucleocapsid monoclonal antibody (Sino Biological), a secondary anti-mouse IgG peroxidase conjugate (Thermo Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed and stained with anti- spike RBD antibody (Sino Biologicals) followed by HRP-conjugated anti-rabbit antibody (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... or the anti-ACE2 antibody (Sino Biological #10108-RP01, 1 μg/ml) at 4 °C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS and stained with rabbit anti-nucleocapsid (Sino biological; 1:2000) in PBS containing 0.1% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-SARS-CoV-2 spike polyclonal antibody (1:3000, Sino Biological) was added and incubated overnight at 4 °C as primary antibody ...
-
bioRxiv - Immunology 2023Quote: ... rabbit anti-SARS-CoV Wuhan spike polyclonal antibody (1:3000) (Sino Biological) was added and incubated overnight at 4L°C as primary antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... Primary antibodies: anti-S IgG rabbit monoclonal antibody (40592-V05H, Sino Biological); rabbit SARS-CoV-2 Nucleocapsid antibody ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibodies anti-SARS-CoV-2 spike (Sino Biological, 20 µg/mL) and K1 anti-dsRNA (Scicons ...
-
bioRxiv - Microbiology 2020Quote: ... Then 10 μL anti-FcγRI antibody-FITC (Cat: 10256-R401-F, Sino Biological), anti-FcγRIIa antibody-FITC (Cat ...
-
bioRxiv - Immunology 2021Quote: ... plate was incubated with rabbit anti-nucleocapsid antibody (Sino Biological, Cat# 40643-T62) for 1h at room temperature on a plate shaker at 800 rpm ...
-
bioRxiv - Bioengineering 2021Quote: ... using an anti-SARS-CoV-2 S polyclonal rabbit antibody (Sino Biological, China). The expression of the E and the M protein were also verified by polyclonal antibodies (data not shown) ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were incubated with anti-S protein Rab (Sino Biological, PA, USA) at 1:1000 in the blocking solution overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SARS-Cov-2 spike S2 (Sino Biological #40590-T62, 1:1000), rabbit anti-β-actin (proteintech #20536-1-AP ...
-
bioRxiv - Microbiology 2020Quote: ... or rabbit anti-SARS-CoV-2 N monoclonal antibody (Sino Biological, 40143-R019) diluted 1:15,000 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... incubated with anti-M13-HRP antibody (Sino Biological, catalog number 11973-MM05T-H) and developed with TMB substrate (Mandel ...
-
bioRxiv - Bioengineering 2022Quote: ... or anti-hCoV HKU1 spike monoclonal Ab (mAb) (40021-MM07-100, Sino Biological) diluted 1:1000 in TBS with 0.1% Tween 20.
-
bioRxiv - Pathology 2022Quote: ... Rabbit anti-SARS-CoV-2 Spike S (1:200, Sino Biological, 40150-R007), Goat anti-ACE2 (1:100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and proceeding with immunofluorescence staining using anti-Nucleocapsid antibody (40143-R019, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... Foci were stained with 50μl/well rabbit anti-nucleocapsid (Sino Biological, 40588-T62) diluted 1:1000 in 0.2% (w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound phage were detected by incubation with anti-M13-HRP conjugate (Sino Biological)(1:5000 ...
-
bioRxiv - Microbiology 2020Quote: ... A primary anti-spike rabbit monoclonal antibody (40150-R007, Sino Biological, 1:100) and a goat anti-rabbit secondary antibody (Alexa Fluor 488 ...
-
bioRxiv - Immunology 2021Quote: ... Bound phages were detected by HRP-conjugated anti-M13 antibody (Sino Biological, China), bound VHH were detected by HRP-conjugated anti-Myc-tag antibody (Abcam ...
-
bioRxiv - Bioengineering 2021Quote: ... Plates were incubated with 1:1000 rabbit anti-RBD primary antibody (Sino Biological Cat# 40592-R001 ...
-
bioRxiv - Microbiology 2020Quote: ... A primary anti-ACE2 rabbit polyclonal antibody (1:200, 10108-T60, Sino Biological) and a goat anti-rabbit secondary antibody (1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... A primary anti-spike rabbit monoclonal antibody (1:100, 40150-R007, Sino Biological) and a goat anti-rabbit secondary antibody (Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2020Quote: ... bound phages were detected using an HRP-conjugated anti-M13 antibody (Sino biological) and tetramethyl benzidine (TMB ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-HA murine mAb (Cat. No. 100028-MM10) was purchased from Sino Biologicals US Inc ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to PVDF membranes and immunoblotted with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...
-
bioRxiv - Neuroscience 2022Quote: ... such as rabbit anti-FcγRI (1:500, Cat: 80016-R015, Sino Biological Inc.), goat anti-FcRγ (1:100 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Blots were incubated with anti-Tph1 R145 primary antibody (Sino Biological; #11931-R145) at a 1:1000 dilution followed by HRP-conjugated anti-rabbit secondary antibody (Jackson ImmunoResearch ...
-
bioRxiv - Microbiology 2023Quote: ... stained with rabbit anti-SARS-S1 antibody (1/1000, Sino Biological, 40591-T62) followed by anti-rabbit IgG-HRP (1/2000 ...
-
bioRxiv - Systems Biology 2023Quote: ... blocked with 5 % BSA stained with primary anti-NP (Sino Biological 40143-R001), and secondary goat anti-rabbit IgG conjugated to Alexa Fluor 488 (Thermo Fisher Scientific A-11034) ...
-
bioRxiv - Bioengineering 2023Quote: ... and HRP-conjugated anti-M13 antibody (Sino Biological, 11973-MM05T-H, 1:4,000) were used to determine the amount of bound antibody or M13 bacteriophage ...
-
bioRxiv - Microbiology 2023Quote: ... cross-reactive rabbit anti-SARS-CoV N monoclonal antibody (40143-R001, Sino Biological) (1:20,000 ...