Labshake search
Citations for Sino Biological :
651 - 691 of 691 citations for Hepatitis E Virus Capsid Protein ORF2 Mouse Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Plasmids expressing the SARS-CoV and SARS-CoV-2 S proteins were purchased from Sino Biologicals (catalog # VG40150-G-N; VG40589-CY). Expression of different coronavirus E proteins ...
-
bioRxiv - Bioengineering 2023Quote: ... The libraries were subjected to five rounds of biopanning against the recombinant SARS-CoV-2 BA.1 RBD protein (Sino Biological Inc.) as described previously38 ...
-
bioRxiv - Immunology 2023Quote: ... 26.4 pmol His-Tagged Biotinylated SARS-CoV-2 (2019-nCoV) spike RBD Recombinant Protein (Sino Biological Inc.; cat number: 40592-VO8H-B) was firstly incubated for 1 hour with 3.78 pmol Streptavidin Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... The S protein expression from cell lysates was analyzed by Western blot using an anti-SARS-CoV-2 RBD polyclonal antibody (Sino Biological, China) and GAPDH as a loading control.
-
bioRxiv - Microbiology 2020Quote: ... cells were incubated for 2 h at room temperature with mouse anti-MERS-CoV N IgGs (1:000 dilution, Sino Biological, China), followed by 1 h of incubation with Alexa Fluor 488-labeled goat anti-mouse IgG (2.5 µg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Neuroscience 2019Quote: ... CSF and plasma sTREM2 concentrations were calculated using the standard curve generated for each plate using recombinant human TREM2 protein (Sino Biological, Wayne, PA). A dedicated CSF and plasma sample was loaded onto all plates and used to normalize values ...
-
bioRxiv - Immunology 2021Quote: ... Cells infected with MV-014-212 were stained with primary rabbit anti-SARS-CoV-2 spike protein polyclonal antisera (Sino Biologicals, Beijing, China). The plates were incubated for 1 hour at room temperature with constant rocking ...
-
bioRxiv - Bioengineering 2021Quote: ... was incubated with 5 ng/µl of SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant Protein (Sino Biological #40589-V08B1) in phosphate buffer (pH 6.0) ...
-
bioRxiv - Microbiology 2020Quote: ... For the detection of SARS-CoV-2 spike protein a rabbit polyclonal anti-SARS-CoV-2 spike S2 antibody (Sino Biological #40590-T62) was used.
-
bioRxiv - Immunology 2021Quote: ... Potency was assessed using a cell-based immunosorbent assay to quantify infection by detecting the SARS-CoV-2 nucleoprotein using a specific antibody raised against this protein (Sino Biological, Wayne, PA). The secondary antibody (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and incubated the monolayer with the rabbit polyclonal antibody specific to SARS-CoV-2 RBD protein (1:200) (cat. n° 40592-T62, Sino Biological, Beijing, China), and a chicken antiserum specific to Newcastle disease virus (1:200 ...
-
bioRxiv - Microbiology 2021Quote: Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep ...
-
bioRxiv - Microbiology 2020Quote: The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
bioRxiv - Immunology 2023Quote: ... vaccines were formulated in 100 μL of PBS 1X and contained a 10 µg antigen dose of spike S1+S2 ECD (R683A, R685A, F817P, A892P, A899P, A942P, K986P, V987P)-His Recombinant Protein (Sino Biological 40589-V08H4) and a 20 µg 30% CpG-NPs adjuvant dose ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg of recombinant SARS-CoV-2 (2019-nCoV) spike S1 protein (Cat: 40591-V08H and 40591-V08H10, Sino Biological, endotoxin level: <0.001U/μg) was used per dose ...
-
bioRxiv - Genetics 2020Quote: ... Loaded sensors were dipped into recombinant SARS-Cov-2 His-tagged Spike protein (D614 or D614G, Sino Biological, Cat # 40591-V08H and 40591-V08H3).
-
bioRxiv - Immunology 2020Quote: ... and ADI-56046) were subject to two rounds of selection for binding to a recombinant SARS-CoV-2 S1 protein (Sino Biological, Cat # 40591-V08H). Induced yeast libraries covering at least 10-fold of their respective diversities were incubated with 10 or 1 nM biotinylated SARS-CoV-2 S1 protein under equilibrium conditions ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with an anti-SARS-CoV/SARS-COV-2 nucleocapsid (N) protein rabbit monoclonal antibody (#40143-R001, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at RT for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; S2, Invitrogen #PA1-41165; RBD, Sino Biological #40592-MP01) then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG (Bethyl ...
-
bioRxiv - Immunology 2020Quote: ... RBD219-N1C1 was detected using a rabbit monoclonal antibody against the SARS-CoV-2 Spike S1 protein (Sino Biological, Beijing, China; Cat#: 40150-R007) and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 4% PFA and were incubated with either a polyclonal antibody against the SARS-CoV-2 RBD protein (Sino Biological, Cat#40592-T62) or a monoclonal antibody against the SARS-CoV-2 S1 protein (MyBioSource ...
-
bioRxiv - Bioengineering 2023Quote: ... The sample solutions were prepared by spiking biotinylated SARS-CoV-2 N protein rabbit monoclonal antibody (no. 40143-R004-B; Sino Biological, Inc.; Beijing, China) in buffer solution (0.1% BSA and 0.05% Tween 20 in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were permeabilised in methanol 0.6% H2O2 and stained for 1 h with an antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; 40143-R019, 1:300 dilution). Cells were further stained with the secondary antibody anti-rabbit HRP conjugate (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... followed by rabbit monoclonal antibody against SARS-CoV2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Microbiology 2021Quote: ... Infected cells were labelled with a mixture of the mouse monoclonal antibody J2 against dsRNA (Scicons, diluted 1:400) and a rabbit polyclonal antibody directed against the spike protein (Sino Biological Inc, diluted 1:500) in PBS supplemented with 5% GS for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... followed by rabbit monoclonal antibody against SARS-CoV-2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Biochemistry 2021Quote: ... or S2-His proteins expressed in HEK293 (S1 and RBD) or insect cells (S2) were used (Sino Biological 40591-V08H, 40592-VNAH, and 40590-V08B). Native mass spectrometry (Olinares et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Tissue sections were incubated overnight at 4°C with primary antibody against the SARS-CoV-2 nucleocapsid protein (1:1000, Sino Biologicals US Inc, Wayne, PA). After washing 3 times with wash buffer ...
-
bioRxiv - Immunology 2021Quote: ... 96 well NUNC MaxSorb flat-bottom plates were coated with 3.99 μg/ml recombinant SARS-CoV-2 Wuhan-Hu-1 spike RBD protein (Sino Biological, Beijing, PR China, Cat. 40592-V08B), 1 μg/ml SARS-CoV-2 Wuhan-Hu-1 nucleocapsid protein (Sino ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated overnight at 4°C with a primary antibody for SARS-CoV-2 (2019-nCoV) S protein (Sino Biological, 40589-T62; diluted 1:2,000 in PBS-T). Next ...