Labshake search
Citations for Sino Biological :
301 - 306 of 306 citations for Siglec 15 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... spleen and tracheobronchial lymph node were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at room temperature for forty five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...