Labshake search
Citations for Sino Biological :
301 - 303 of 303 citations for Granzyme D GZMD Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...