Labshake search
Citations for Sino Biological :
201 - 250 of 496 citations for Parvalbumin PVALB cDNA ORF Clone Mouse N His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... pCMV3-N- FlagPI31wt was obtained from Sino Biological Inc (catalog #HG17079-NF) ...
-
bioRxiv - Physiology 2023Quote: ... or FLOT2-N-myc (Sino Biological, Wayne, PA) were lysed at 2°C in lysis buffer (0.5% CHAPS (Millipore-Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-CAD-Fc (Sino Biological; #11039-H03H) was reconstituted according to manufacturer’s instructions and diluted in distilled water to a concentration of 100 ng µl-1 or 250 ng µl-1 ...
-
bioRxiv - Microbiology 2024Quote: ... MERS-CoV N (Sino Biological, #40068-RP01-200), IFIT1 (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... pCMV3-N-HA-PTPN12 (Sino Biological, #HG11556-NY), and pTwist-CMV-PTPN12YF synthesized by Twist Bioscience ...
-
bioRxiv - Immunology 2021Quote: ... ligand human ACE-2-mFc tag (Sino Biological; 125 ng/ml final concentration) was added in the same dilution buffer ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 (cat. n° 40592-R001 and cat. n° 40150-R007, Sino Biological)
-
bioRxiv - Microbiology 2023Quote: Expi293F cells were transfected with 500 ng of plasmid expressing myc-tagged full-length Eph receptor (pCEP4-myc-Eph for EphB1, B2, B4, and B6; pCMV3-SP-N-Myc-EphA4 and pCMV3-SP-N-Myc-EphB3, Sino Biological) per mL of culture at 2 ξ 106 cells/mL using Expifectamine (ThermoFisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... were immunized with 2 µg of prefusion-like gB-C7 ectodomain (n= 5) or full-length postfusion gB lacking the transmembrane domain (n = 5) (Sino Biologicals) at weeks 0 ...
-
bioRxiv - Genetics 2020Quote: ... Recombinant His-tagged and biotinylated human ACE2 protein (Sino Biological, Cat # 10108-H08H-B) was immobilized on a Streptavidin (SA ...
-
bioRxiv - Microbiology 2021Quote: ... Live cells were incubated with the recombinant proteins RBD-His with mutations (Sino Biological Cat ...
-
bioRxiv - Microbiology 2021Quote: ... was incubated with 5 nM HIS-tagged SARS-CoV-2 Spike-RBD (Sino Biological) in the presence of 5 μg/mL nickel chelate donor bead in a total of 10 μL of 20 mM Tris (pH 7.4) ...
-
bioRxiv - Developmental Biology 2022Quote: ... and His-tagged recombinant extracellular domain of Human PTH1R (Cat: 12232-H08H, Sino biological) were used ...
-
bioRxiv - Immunology 2023Quote: B.1.1.529 (BA.1) S1 + S2 Trimer-His Recombinant Protein (Sino Biologicals; 40589-V08H26) was reconstituted in sterile water (100 μl ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... and recombinant SARS-Cov-2 His-tagged S protein (Sino Biological, Cat #40591-V08H). Binding was analyzed using an Octet RED96 instrument (ForteBio) ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV2-S1 (Sino Biological, 40591-V08H, n=3) and SARS-CoV2-S2 (Sino Biological ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Nucleoprotein (N; Sino Biological #40143-R019, 1:5000) overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Rabbit monoclonal anti-N antibody (Sino Biologicals #40143-R001) was diluted 1:5,000 in 0.1% Tween-20 in PBS (PBS-T) ...
-
bioRxiv - Microbiology 2022Quote: ... or anti-N antibody (1:5,000 dilution; Sino Biological). The immune complexes were visualized with SuperSignal West Femto substrate (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... followed by ACE-2-mFc Tag ligand (Sino Biological; final concentration 125 ng/ml). After incubation for 1h at room temperature and washing ...
-
bioRxiv - Bioengineering 2021Quote: ... Tag-free and histidine tagged human IL-12 were both purchased from Sino Biologicals.
-
bioRxiv - Immunology 2020Quote: ... Purified recombinant SARS-CoV-2 S1 and RBD with histidine tags (both Sino Biological) were used for surface plasmon resonance (SPR ...
-
bioRxiv - Immunology 2022Quote: Human PGRP3 cDNA (Sino Biological) encoding a 357 residue peptide was amplified via polymerase chain reaction using the forward primer 5’-C ATG GAG GCC GAA TTC ATG GCC TTC TTC ATT CTG GGT CTC and reverse primer 5’-G CAG GTC GAC GGA TCC TCA GTG CTT GAA ATG AGG CCA GGT ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Bioengineering 2020Quote: Sensor tips were removed from peptide solutions and introduced to 35μM RBD-his (Sino Biological) (Figure 3e - 3h).
-
bioRxiv - Microbiology 2021Quote: The following recombinant proteins were used: SARS-CoV-2 S1-His (Sino Biological # 40591-V08B1), SARS-CoV-2 N-His (Sino Biological # 40588-V08B) ...
-
bioRxiv - Microbiology 2022Quote: ... RBD-his proteins of SARS-CoV-2 and Omicron variant were purchased from Sino Biological. Genes of bispecific antibodies were synthesized by Genscript ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 spike S1+S2 ECD-His recombinant protein was purchased from Sino Biological Inc ...
-
bioRxiv - Microbiology 2020Quote: ... ACE2-hFc and SARS-CoV-2 RBD-His were purchased from Sino Biological (Beijing, China). SARS-CoV-2 RBD-mFc was expressed using ABLINK Biotech’s HEK 293F expression system.
-
bioRxiv - Microbiology 2023Quote: ... Recombinant SARS-CoV-2 B.1.1.529 (Omicron BA.1) Spike RBD-His protein (Sino Biological) was diluted with the 10X Kinetic Buffer (Sartorius ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using recombinant His-tagged and biotinylated human ACE2 protein (Sino Biological, Cat 10108-H08H-B) and recombinant SARS-Cov-2 His-tagged S protein (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... and SARS-CoV2-S2 (Sino Biological, 40590-V08B, n=3), respectively ...
-
bioRxiv - Microbiology 2021Quote: ... against N protein from Sino Biological (#40143-R019, 1:1000), and against calnexin from Enzo (#ADI-SPA-860-F ...
-
bioRxiv - Biophysics 2021Quote: anti-N IgG rabbit monoclonal antibody (40143-R019, Sino Biological), dilution ...
-
bioRxiv - Immunology 2022Quote: ... and 1 μg/ml N protein (Sino Biological, PA, USA) onto ELISA plates (Corning ...
-
bioRxiv - Immunology 2020Quote: ... Purified recombinant SARS-CoV-2 S1 and RBD with a histidine tag (both Sino Biological) were used for surface plasmon resonance (SPR ...
-
bioRxiv - Immunology 2022Quote: ... anti-spike RBD (clone MM57, Sino Biological) in FACS buffer (PBS containing 2% BCS ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was washed with buffer and 100 µl HRP-conjugated anti-his antibody (Sino Biological) was added to each well and incubated at room temperature for 1 h ...
-
bioRxiv - Microbiology 2021Quote: His-tagged full-length SARS-CoV-2 S protein (50 ng) (Cat. # 40589-V08B1, Sino Biological) was used as a coating reagent ...
-
bioRxiv - Immunology 2020Quote: ... then loaded for 300 s with 2.5 μg/mL ACE2-His (residues 1 – 740) (Sino Biological) or truncated ACE2 (described above for the mix-and-read assay ...
-
bioRxiv - Microbiology 2024Quote: ... His-tagged FcγR ectodomains were used at a final concentration of 5 µg/ml (Sino Biological). Dead cells were labeled via DAPI stain ...
-
bioRxiv - Immunology 2024Quote: ... His-tagged H1N1 A/California/04/2009 full length trimer Y97F (Sino Biological Cat # 11055-V08B1) was mixed in 4:1 molar ratios with SA-Allophycocyanin (APC ...
-
bioRxiv - Neuroscience 2024Quote: ... Cdh13 cDNA purchased from Sino Biological was subcloned into Cre-activated plasmid backbone (CB-FLEX) ...
-
bioRxiv - Immunology 2020Quote: ... 96 well plate was coated with RBD recombinant protein (0.5 μg/ml, Fc tag; Sino Biological) at 4 oC overnight ...
-
bioRxiv - Immunology 2020Quote: ... and nucleocapsid (N) protein (40588-V08B) was purchased from Sino Biological, USA ...
-
bioRxiv - Immunology 2021Quote: ... and N proteins (Sino Biological 40589-V08B1, 40592-V08H, 40588-V08B), or Beta ...
-
bioRxiv - Cell Biology 2022Quote: ... His-tagged S1 and S1-RBD of SARS-CoV-2 were purchased from Sino Biological (40591-V08H) and R&D Systems (10523-CV;) ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCoV) Spike RBD-His Recombinant Protein (Sino Biological, Cat. No. 40592-V08B-100) was used as a positive control ...
-
bioRxiv - Immunology 2020Quote: ... Biotinylated SARS-CoV-2 full length nucleocapsid (Avi- and His-tagged; Sino Biological, Cat# 40588-V27B-B) was multimerized using streptavidin PE (BioLegend ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 1 μg/ml recombinant RBD-His protein antigen (Cat. No. 40592-V08H, Sino Biological) in 1x D-PBS overnight at 4°C ...