Labshake search
Citations for Sino Biological :
201 - 250 of 439 citations for Mouse Anti Rubella virus Glycoprotein E1 1715 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... We used rabbit polyclonal anti-PR8 HA antibody (Sino Biological), SARS-CoV-2 Spike S2 Subunit Antibody (R&D systems) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-MERS-CoV-Spike (Sino Biological, 100208-RP02, 1:1000), anti-Renilla Luciferase (abcam ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2 N protein (40143-MM05, Sino Biological), anti-HuR antibody (3A2 ...
-
bioRxiv - Microbiology 2023Quote: ... rabbit polyclonal anti- HA1 antibody from Sino Biological (Beijing, China) (11692-T54) ...
-
Analysis of spike protein variants evolved in a novel mouse model of persistent SARS-CoV-2 infectionbioRxiv - Microbiology 2023Quote: ... rabbit anti-SARS-CoV-2 S polyclonal antibody (Sino Biological, cat ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:200), or anti-HA (H3663 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:1000), anti-β-tubulin (ab6046 ...
-
bioRxiv - Bioengineering 2024Quote: ... Anti-Human IgG-Fc Secondary Antibody (Sino Biological, Beijing, China), ELISA basic kit (Multi Science ...
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Microbiology 2020Quote: SARS-CoV-2 spike specific antibody was generated by immunized Balb/c mouse with SARS-CoV-2 spike protein (RBD, Fc Tag, 40592-V05H, Sino Biological inc). MAbs against SARS-CoV-2 RBD were produced using hybridoma technology and were characterized by pseudotyped virus assay.
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... the sections was incubated with corresponding primary antibodies (anti-CD147, HAb18, produced by our laboratory, dilution 1:200; anti-SARS-CoV-2 Spike antibody, 40150-R007, Sino Biological, China, dilution 1:400) for 16 hours at 4°C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... the membrane was incubated with the corresponding primary antibodies (anti-CD147, HAb18, produced by our laboratory, dilution 1:2000; anti-SARS-CoV-2 Spike antibody, 40150-R007, Sino Biological, China, dilution 1:2000) at 4°C overnight ...
-
bioRxiv - Immunology 2021Quote: ... an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc, Beijing, China) was diluted in iBind solution (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... and rabbit anti-SARS-CoV-2 S1 IgG Antibody (Sino biologicals, Catalog number ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-SARS-CoV-2 spike pAb (Sino Biological, 40592-T62), or anti-hCoV HKU1 spike monoclonal Ab (mAb ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cells were incubated with anti-Spike protein Rab (Sino Biological) at 1:1000 in blocking solution overnight at 4°C ...
-
bioRxiv - Pathology 2021Quote: ... rabbit-derived anti-CD4 primary antibody (Sino Biological, Cat# 10400-R), diluted 1:200 in antibody dilution buffer (Ventana ...
-
bioRxiv - Immunology 2020Quote: ... anti SARS-CoV-2 RBD antibody (Cat# 40592-T62, Sino Biological) was used to stain intracellularly ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... rabbit anti-Spike neutralizing Antibody 1:100 (40592-R001, Sino Biological), mouse anti-CD81 1:100 (sc7637 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-SARS-CoV spike polyclonal antibody (1:3000) (Sino Biological), or rabbit anti-SARS-CoV nucleoprotein (1:3,000 ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HRP-labeled Anti-His tag Antibody (105327-MM02T-H, Sino Biological) was then incubated at 37°C for an additional hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... anti-M13-HRP conjugated antibody (0.4 µg/mL, Sino Biological, USA) was then added followed by 1-hour incubation at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Immunology 2020Quote: ... anti-SARS-CoV-1 N rabbit monoclonal antibody (40143-R001, Sino Biological), and anti-vaccinia rabbit polyclonal antibody (9503-2057 ...
-
bioRxiv - Molecular Biology 2019Quote: ... An anti-Tf antibody (1:2000, 11019-RP02, Sino Biological Inc, China) was used in the immunoreactivity ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Immunology 2021Quote: ... we used rabbit anti-SARS-CoV-2 spike polyclonal antibody (Sino Biological) and goat anti-rabbit HRP- conjugated secondary antibody (Jackson ImmunoResearch) ...
-
bioRxiv - Microbiology 2020Quote: ... Anti-SARS-CoV-2 N protein antibody was purchased from Sino Biological Inc ...
-
bioRxiv - Immunology 2022Quote: ... Anti-spike RBD antibody (clone MM57) obtained from Sino Biologicals (Cat#40592). FITC-conjugated goat secondary antibody against mouse IgG/IgM was purchased from BD Pharmingen (Cat# 555988) ...