Labshake search
Citations for Sino Biological :
151 - 164 of 164 citations for Mouse NGF beta ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and tracheobronchial lymph node were covered with a mouse monoclonal anti-SARS-CoV nucleocapsid protein (#40143-MM05, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at room temperature for forty five minutes ...
-
bioRxiv - Microbiology 2022Quote: ... followed by radiolabeling and immunoprecipitation analysis using a mouse monoclonal antibody directed against the HA-tag (Thermo-Fisher, #26183) or an antibody against SARS-CoV Spike protein (Sino Biologicals, #40590-T62).
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2024Quote: ... Sections of the head were prepared to expose different regions of the nasal cavity and were stained with hematoxylin-eosin or an immunohistochemistry (IHC) staining kit using a SARS-CoV-2 spike RBD-specific antibody (Sino Biological). The damage score of each section was defined as 0 ...