Labshake search
Citations for Sino Biological :
101 - 150 of 223 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... the recombinant human CHL1 partial protein (10143-H08H; Sino Biological, Beijing, China) was used as a standard.
-
bioRxiv - Biochemistry 2020Quote: ... the recombinant human CHL1 partial protein (10143-H08H; Sino Biological, Beijing, China) was used as a standard.
-
bioRxiv - Microbiology 2021Quote: ... was incubated with 5 nM HIS-tagged human PD-1 (Sino Biological) in the presence of 5 μg/mL protein A AlphaScreen acceptor bead and 5 μg/mL nickel chelate donor bead in a total volume of 10 μL of 20 mM HEPES (pH 7.4) ...
-
bioRxiv - Neuroscience 2020Quote: ... a human pCMV-Dicer 1(Sino Biological, Beijing, China, cat# HG11350-NH), U87MG cell line(ATCC ...
-
bioRxiv - Microbiology 2020Quote: ... or human coronavirus OC43 antigen (spike glycoprotein extracellular domain: Sino Biological, China) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... of the human ACE2 coding sequence (Sino Biological, Beijing China, #HG10108-M) into LeGO-iC2 (Addgene #27345 ...
-
bioRxiv - Pathology 2021Quote: Human ACE2 protein was purchased from Sino Biological (SinoBiological, catalog#10108-H05H) and re-suspended in PBS-T to obtain 4.54uM stock concentration ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 μg mL−1 recombinant human ACE2-Fc (Sino Biologicals, Beijing, China) in running buffer (0.01 M HEPES pH 7.4 ...
-
bioRxiv - Genetics 2020Quote: ... the human COCH cDNA sequence tagged with GFP (Sino Biological, Cat # HG11368ACG) was used ...
-
Chimeric Antigen Cytotoxic Receptors for In-Vivo Engineering of Tumor-targeting Natural Killer CellsbioRxiv - Immunology 2023Quote: A human HER2/ERBB2 protein-His tag (10004-H08H-100, Sino Biological) conjugated with Alexa Fluor 647 was used to determine the expression of HER2-CAR in transfected cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing human SERPINB3 or pLV-C-GFPSpark vector (Sino Biological LVCV-35) containing mouse Serpinb3a GFP-tagged fusion proteins ...
-
bioRxiv - Neuroscience 2024Quote: Recombinant human LDLR (His-tagged) was purchased from Sino Biological (Beijing, China). Interaction of ligands with hLDLR was tested at 25°C using a Biacore T200 apparatus (GE Healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were coated with 0.25 μg/mL human VEGF (Sino Biological, WBP325-hPro1) in carbonate-bicarbonate buffer (20 mM Na□CO□ ...
-
bioRxiv - Biophysics 2022Quote: Recombinant human ACE2 protein (GenBank accession: AF291820.1, Sino Biological 10108-H08H, Wayne, PA) was labeled with RED-NHS (2nd Generation ...
-
bioRxiv - Microbiology 2021Quote: HEK293 was transfected with human ACE2 cDNA cloning vector (HG10108-M, Sino Biological), and sorted with BD FACJazz cell sorter to get monoclonal cell line ...
-
bioRxiv - Cell Biology 2021Quote: ... Vector containing human caspase-5 was obtained from Sino Biological (cat. #HG11152-M). The genes encoding human caspase-1 ...
-
bioRxiv - Biochemistry 2021Quote: ... a solution of Human ACE2-mouse Fc tag (Sino Biological Inc., Eschborn, Germany) at 900 ng/mL in EIA buffer and a solution of biotinylated RBD (recombinant RBD from the SARS-CoV-2 variants Wuhan ...
-
bioRxiv - Immunology 2021Quote: ... ligand human ACE-2-mFc tag (Sino Biological; 125 ng/ml final concentration) was added in the same dilution buffer ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Human hepatocyte growth factor (HGF; Entrez Gene 3082) was purchased from Sino Biological, Inc ...
-
bioRxiv - Immunology 2020Quote: ... or K562-CD19 cells were transduced to express human PD-L1 (Sino Biological; HG10084-UT cDNA subcloned into a lentiviral vector ...
-
bioRxiv - Immunology 2021Quote: ... pAce2-huFc was produced by subcloning the ectodomain on human ACE2 (Sino Biological) into pCR-Fc using the NotI and BamHI restriction sites ...
-
bioRxiv - Immunology 2020Quote: ... and then human ACE2 recombinant protein (0.25 μg/ml, His tag; Sino Biological) was added to the wells and incubated for 2 h at RT ...
-
bioRxiv - Immunology 2023Quote: ... Polyhistidine-tagged human CTLA-4 (HIS-hCTLA-4) (Sino Biological Inc, 11159-H08H). Mouse TNF-alpha (Sino Biological Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... Human KEAP-1 Protein was bought from Sino Biological (Cat No.11981-HNCB). Recombinant human NRF2 protein was bought from Abcam (Cat No ...
-
bioRxiv - Immunology 2022Quote: ... D614G) forms and recombinant human Fc-tagged ACE-2 were purchased by Sino Biological Europe ...
-
bioRxiv - Microbiology 2021Quote: The human ACE2 protein was purchased from Sino Biological (Beijing, China; Cat# 10108-H08H) and the human IgG1 Fc-tagged RBD proteins were made in-house using a method as previously described35 ...
-
bioRxiv - Biochemistry 2021Quote: The cDNA for human ACE2 (Uniprot: Q9BYF1) was purchased from Sino Biological (HG10108-M). cDNAs encoding the SARS-CoV-2 genes for ORF6 ...
-
bioRxiv - Bioengineering 2021Quote: ... Tag-free and histidine tagged human IL-12 were both purchased from Sino Biologicals.
-
bioRxiv - Biochemistry 2021Quote: ... Full-length human MAVS cDNA was transferred from pGEM- MAVS (Sino Biological HG15224-G) into the KpnI-NotI sites of the pCMV6-Entry vector (OriGene Technologies #PS100001 ...
-
bioRxiv - Microbiology 2021Quote: The human ACE2 protein was purchased from Sino Biological (Beijing, China; Cat# 10108-H08H) and the human IgG1 Fc-tagged RBD proteins were made in-house using a method as previously described28 ...
-
bioRxiv - Genetics 2020Quote: ... Recombinant His-tagged and biotinylated human ACE2 protein (Sino Biological, Cat # 10108-H08H-B) was immobilized on a Streptavidin (SA ...
-
bioRxiv - Immunology 2020Quote: The MerTK (Mer cDNA ORF Clone, Human, untagged, pCMV3) was obtained from Sino Biological. Both pcDNAI-GAL4-CREB and 5xGAL4-TATA-luciferase were a gift from Richard Maurer(Sun et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The pCMV3-N-Myc-human AXL (HG10279-NM) plasmid was purchased from Sino Biological. The peGFP-C1-KRas4A ...
-
bioRxiv - Immunology 2021Quote: ... D614G) forms and recombinant human Fc-tagged ACE-2 were purchased by Sino Biological Europe ...
-
bioRxiv - Immunology 2023Quote: ... Cells were incubated with 100nM human or mouse PC (HTI and Sino Biologicals, respectively) and 5nM thrombin (HTI ...
-
bioRxiv - Developmental Biology 2022Quote: ... and His-tagged recombinant extracellular domain of Human PTH1R (Cat: 12232-H08H, Sino biological) were used ...
-
bioRxiv - Biophysics 2021Quote: For affinity measurements of anti-human coronavirus spike glycoprotein HKU1 (40021-MM07-100, Sino Biological) to HCoV-HKU1 S1 protein ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ligand blocking was performed by pre-adsorbing HPK with soluble human HER3 peptide (Sino Biological) at 10× molar excess in PBS before adding to cells ...
-
bioRxiv - Immunology 2021Quote: ... Human ACE2 protein His Tag and SARS-CoV-2 spike were purchased from Sino Biological, Beijing ...
-
bioRxiv - Immunology 2020Quote: ... Mouse-Human chimeric mAb D001 (SARS-CoV RBD mAb; Sino Biological Inc Cat# 40150-D001) was used as a control mAb ...
-
bioRxiv - Molecular Biology 2021Quote: ... recombinant human ACE2-mIgG1 (2 μg/ml, diluted in blocking buffer, Sino Biological, 10108-H05H) or recombinant human ACE2-hIgG1 (2 μg/ml ...
-
bioRxiv - Bioengineering 2021Quote: ... wells were washed with PBS-T and further incubated with human ACE2-Fc (Sino Biological) for 2 hours at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... C-terminal Myc-tagged human ZAP-70 was purchased from Sino Biological (HG10116-CY, China). PH-PLCδ-GFP ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Antibodies against human PCNA (proliferating cell nuclear antigen, rabbit) were purchased from Sino Biological (China). DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Developmental Biology 2024Quote: The I-BAR domain of human Mtss1 was purchased from Sino Biological (Cat 13085-H10E). The human Plexin-D1 cytosolic domain was prepared ...
-
bioRxiv - Microbiology 2023Quote: ... cells were treated with varying doses of recombinant human IFN-α2 (Sino Biological; 13833-HNAY), IFN-β (Peprotech ...
-
bioRxiv - Biochemistry 2023Quote: ... Expression plasmids in human cells of untagged RFPL4 and PTOV1 were purchased from Sino Biological (products HG25044-UT and #HG20551-UT ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using recombinant His-tagged and biotinylated human ACE2 protein (Sino Biological, Cat 10108-H08H-B) and recombinant SARS-Cov-2 His-tagged S protein (Sino Biological ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
Androgen Regulates SARS-CoV-2 Receptor Levels and Is Associated with Severe COVID-19 Symptoms in MenbioRxiv - Cell Biology 2020Quote: ... 0.5 μM/mL human Fc-tagged recombinant spike-RBD protein with (Sino Biological Inc. 40592-V02H) was added to the medium and incubated for 30 minutes ...