Labshake search
Citations for Sino Biological :
901 - 950 of 1057 citations for Mouse Anti Hepatitis B Virus Core Protein Antibody 1823 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Neuroscience 2019Quote: ... CSF and plasma sTREM2 concentrations were calculated using the standard curve generated for each plate using recombinant human TREM2 protein (Sino Biological, Wayne, PA). A dedicated CSF and plasma sample was loaded onto all plates and used to normalize values ...
-
bioRxiv - Biochemistry 2020Quote: ... via baculovirus and S protein (S1 and RBD, His tag) expressed in human embryonic kidney cells (HEK293) were purchased from Sino Biological (Beijing, China). Sequencing-grade trypsin and Glu-C were obtained from Enzyme & Spectrum (Beijing ...
-
bioRxiv - Biochemistry 2020Quote: ... (Cat # 10108-H08H), and S1-His (spike protein residues 1-667, C-terminal His tag) (Cat # 40150-V08B1) were acquired from Sino Biological (Wayne, PA). All proteins were reconstituted in 1X PBS at pH 7.4 supplemented with 0.05 mg/mL bovine serum albumin (BSA) ...
-
bioRxiv - Bioengineering 2021Quote: ... was incubated with 5 ng/µl of SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant Protein (Sino Biological #40589-V08B1) in phosphate buffer (pH 6.0) ...
-
bioRxiv - Immunology 2022Quote: ... pre-incubated beads were incubated a second time with 2 µg of a recombinant human DC-SIGN protein with a human Fc tag (Sino Biological, Köln, Germany) for 1 h at 4°C with agitation ...
-
bioRxiv - Microbiology 2021Quote: Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep ...
-
bioRxiv - Biochemistry 2020Quote: ... via a baculovirus, and S protein (S1, His tag) expressed by human embryonic kidney (HEK293) cells were purchased from Sino Biological (Beijing, China). Sequencing-grade trypsin and Glu-C were obtained from Enzyme & Spectrum (Beijing ...
-
bioRxiv - Immunology 2021Quote: ... 1μg of formalin and heat inactivated SARS-CoV 2 adjuvanted in Alhydrogel (Brenntag) 1% or 1.5 μg of recombinant SARS-CoV-2 spike protein (S1+S2 ECD, His tag; Sino Biological, Cat. 40589-V08B1) adjuvanted in Alhydrogel (Brenntag ...
-
bioRxiv - Microbiology 2020Quote: The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
bioRxiv - Immunology 2023Quote: ... vaccines were formulated in 100 μL of PBS 1X and contained a 10 µg antigen dose of spike S1+S2 ECD (R683A, R685A, F817P, A892P, A899P, A942P, K986P, V987P)-His Recombinant Protein (Sino Biological 40589-V08H4) and a 20 µg 30% CpG-NPs adjuvant dose ...
-
bioRxiv - Microbiology 2022Quote: ... immunohistochemistry with a monoclonal antibody detecting SARS-CoV/SARS-CoV-2 nucleocapsid (Sino Biological 40143-MM05) was performed on FFPE tissue sections ...
-
bioRxiv - Immunology 2020Quote: ... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological Inc.) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...
-
bioRxiv - Neuroscience 2020Quote: ... SARS-CoV-2 (2019-nCoV) Nucleoprotein / NP Antibody (rabbit Mab, Sino Biological #40143-R019, 1: 2000) was incubated diluted with blocking solution and incubated with cells for 20 minutes at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... and then incubated with the antibody against CD14 (1:200 dilution, 10073-RP0, Sino Biological, China) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... for MVA/S and rabbit SARS-CoV-2 RBD polyclonal antibody (Cat# 40592-T62, Sino Biological) for MVA/S1 diluted 1:2500 in blocking buffer ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody to SARS-CoV-2 spike subunit 1 (Sino Biological, Beijing, Cat. No. 40589-T62), was diluted 1:25 in blocking solution and grids were transferred to drops of primary antibody for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with a rabbit (2019-nCoV) S1 antibody (1:50; Sino Biological, Duesseldorf, Germany) and then incubated for 1 hour at 37°C with secondary goat anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Immunology 2021Quote: ... an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc, Beijing, China) was diluted in iBind solution (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-SARS-CoV-2 spike pAb (Sino Biological, 40592-T62), or anti-hCoV HKU1 spike monoclonal Ab (mAb ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-MERS-CoV S2 (Sino Biological, 40070-T62, 1:1000), rabbit anti-MyD88 (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg of recombinant SARS-CoV-2 (2019-nCoV) spike S1 protein (Cat: 40591-V08H and 40591-V08H10, Sino Biological, endotoxin level: <0.001U/μg) was used per dose ...
-
bioRxiv - Genetics 2020Quote: ... Loaded sensors were dipped into recombinant SARS-Cov-2 His-tagged Spike protein (D614 or D614G, Sino Biological, Cat # 40591-V08H and 40591-V08H3).
-
bioRxiv - Immunology 2020Quote: ... and ADI-56046) were subject to two rounds of selection for binding to a recombinant SARS-CoV-2 S1 protein (Sino Biological, Cat # 40591-V08H). Induced yeast libraries covering at least 10-fold of their respective diversities were incubated with 10 or 1 nM biotinylated SARS-CoV-2 S1 protein under equilibrium conditions ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Microbiology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Immunology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2020Quote: ... China) were coated with 2 μg/mL (50μL/well) SARS-CoV-2 Spike Protein (S1 Subunit, His tag) (Sino Biological, China, cat no:40591-V08H) in carbonate bicarbonate buffer pH9.6 and the plates were incubated at 4°C overnight ...
-
bioRxiv - Biochemistry 2021Quote: ... or S2-His proteins expressed in HEK293 (S1 and RBD) or insect cells (S2) were used (Sino Biological 40591-V08H, 40592-VNAH, and 40590-V08B). Native mass spectrometry (Olinares et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...