Labshake search
Citations for Sino Biological :
801 - 814 of 814 citations for Recombinant Mouse PPAR gamma Protein His tag since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... RBD219-N1C1 was detected using a rabbit monoclonal antibody against the SARS-CoV-2 Spike S1 protein (Sino Biological, Beijing, China; Cat#: 40150-R007) and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 4% PFA and were incubated with either a polyclonal antibody against the SARS-CoV-2 RBD protein (Sino Biological, Cat#40592-T62) or a monoclonal antibody against the SARS-CoV-2 S1 protein (MyBioSource ...
-
bioRxiv - Bioengineering 2023Quote: ... The sample solutions were prepared by spiking biotinylated SARS-CoV-2 N protein rabbit monoclonal antibody (no. 40143-R004-B; Sino Biological, Inc.; Beijing, China) in buffer solution (0.1% BSA and 0.05% Tween 20 in PBS ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were permeabilised in methanol 0.6% H2O2 and stained for 1 h with an antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; 40143-R019, 1:300 dilution). Cells were further stained with the secondary antibody anti-rabbit HRP conjugate (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... followed by rabbit monoclonal antibody against SARS-CoV2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Microbiology 2021Quote: ... Infected cells were labelled with a mixture of the mouse monoclonal antibody J2 against dsRNA (Scicons, diluted 1:400) and a rabbit polyclonal antibody directed against the spike protein (Sino Biological Inc, diluted 1:500) in PBS supplemented with 5% GS for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... followed by rabbit monoclonal antibody against SARS-CoV-2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Microbiology 2023Quote: ... Tissue sections were incubated overnight at 4°C with primary antibody against the SARS-CoV-2 nucleocapsid protein (1:1000, Sino Biologicals US Inc, Wayne, PA). After washing 3 times with wash buffer ...
-
bioRxiv - Immunology 2023Quote: ... Paraffin blocks containing the left lung lobe were sectioned at approximately 4 microns and stained using hematoxylin and eosin (H&E) or immunostained using a rabbit monoclonal antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; cat. no. 40588-R002) and rabbit polyclonal antibodies against CD-3 protein (Dako ...
-
bioRxiv - Bioengineering 2023Quote: Nectagen’s nanoCLAMP phage display library NL-21 was panned as described (Suderman et al. 2017) against SARS CoV 2 Spike protein RBD (Sino Biologicals, S1RBD-Fc, cat#40592-VO2H) for rounds 1 and 2 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated overnight at 4°C with a primary antibody for SARS-CoV-2 (2019-nCoV) S protein (Sino Biological, 40589-T62; diluted 1:2,000 in PBS-T). Next ...