Labshake search
Citations for Sino Biological :
651 - 681 of 681 citations for Recombinant Mouse COL3A1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... Samples were then incubated in a primary mouse SARS-CoV-2 nucleocapsid (N) antibody (Sino Biological Inc., Cat # 40588-T62, 1:1000) at 4 °C overnight ...
-
bioRxiv - Immunology 2021Quote: ... Cells infected with MV-014-212 were stained with primary rabbit anti-SARS-CoV-2 spike protein polyclonal antisera (Sino Biologicals, Beijing, China). The plates were incubated for 1 hour at room temperature with constant rocking ...
-
bioRxiv - Biochemistry 2020Quote: ... via baculovirus and S protein (S1 and RBD, His tag) expressed in human embryonic kidney cells (HEK293) were purchased from Sino Biological (Beijing, China). Sequencing-grade trypsin and Glu-C were obtained from Enzyme & Spectrum (Beijing ...
-
bioRxiv - Biochemistry 2020Quote: ... (Cat # 10108-H08H), and S1-His (spike protein residues 1-667, C-terminal His tag) (Cat # 40150-V08B1) were acquired from Sino Biological (Wayne, PA). All proteins were reconstituted in 1X PBS at pH 7.4 supplemented with 0.05 mg/mL bovine serum albumin (BSA) ...
-
bioRxiv - Microbiology 2020Quote: ... For the detection of SARS-CoV-2 spike protein a rabbit polyclonal anti-SARS-CoV-2 spike S2 antibody (Sino Biological #40590-T62) was used.
-
bioRxiv - Immunology 2021Quote: ... Potency was assessed using a cell-based immunosorbent assay to quantify infection by detecting the SARS-CoV-2 nucleoprotein using a specific antibody raised against this protein (Sino Biological, Wayne, PA). The secondary antibody (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... and incubated the monolayer with the rabbit polyclonal antibody specific to SARS-CoV-2 RBD protein (1:200) (cat. n° 40592-T62, Sino Biological, Beijing, China), and a chicken antiserum specific to Newcastle disease virus (1:200 ...
-
bioRxiv - Microbiology 2021Quote: Biotinylated SARS-CoV-2 Spike D614G protein (Spikebiotin, in-house generated) or the biotinylated SARS-CoV-2 Spike receptor-binding domain (RBDbiotin, Sino Biological, 40592-V08B) were incubated with Alexa Fluor® 647 streptavidin (AF647-strep ...
-
bioRxiv - Biochemistry 2020Quote: ... via a baculovirus, and S protein (S1, His tag) expressed by human embryonic kidney (HEK293) cells were purchased from Sino Biological (Beijing, China). Sequencing-grade trypsin and Glu-C were obtained from Enzyme & Spectrum (Beijing ...
-
bioRxiv - Microbiology 2020Quote: The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
bioRxiv - Immunology 2021Quote: ... paraffin-embedded lung were incubated for 1 hour with the primary antibodies SARS-CoV-2 nucleoprotein (mouse IgG1, catalog number 40143-MM08, Sino Biological, Wayne, PA), Ionized calcium-binding adaptor (IBA1 ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2021Quote: ... sections were stained with an anti-SARS-CoV/SARS-COV-2 nucleocapsid (N) protein rabbit monoclonal antibody (#40143-R001, Sino Biological, Chesterbrook, PA, USA) at a dilution of 1:6000 and incubated at RT for 45 min ...
-
bioRxiv - Immunology 2021Quote: ... blots were incubated with an anti-SARS-CoV spike protein polyclonal antibodies (S1, Sino Biological #40591-T62; S2, Invitrogen #PA1-41165; RBD, Sino Biological #40592-MP01) then visualized with horseradish peroxidase (HRP)-conjugated anti-mouse or anti-rabbit IgG (Bethyl ...
-
bioRxiv - Immunology 2020Quote: ... RBD219-N1C1 was detected using a rabbit monoclonal antibody against the SARS-CoV-2 Spike S1 protein (Sino Biological, Beijing, China; Cat#: 40150-R007) and goat anti-rabbit IgG secondary antibodies conjugated with horseradish peroxidase (Invitrogen ...
-
bioRxiv - Immunology 2021Quote: ... Cells were fixed with 4% PFA and were incubated with either a polyclonal antibody against the SARS-CoV-2 RBD protein (Sino Biological, Cat#40592-T62) or a monoclonal antibody against the SARS-CoV-2 S1 protein (MyBioSource ...
-
bioRxiv - Bioengineering 2023Quote: ... The sample solutions were prepared by spiking biotinylated SARS-CoV-2 N protein rabbit monoclonal antibody (no. 40143-R004-B; Sino Biological, Inc.; Beijing, China) in buffer solution (0.1% BSA and 0.05% Tween 20 in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Pathology 2020Quote: ... for 40 minutes, followed by a 60-minute incubation with the primary antibodies (SARS-CoV-2 nucleoprotein, mouse IgG1 (Sino Biological, cat#40143-MM08); ACE2 ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 antigen production in cells was detected by successive incubations with an anti-SARS-CoV nucleoprotein mouse monoclonal antibody (Sino Biological catalog# 40143-MM05), HRP IgG conjugate (Jackson ImmunoResearch Laboratories ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were permeabilised in methanol 0.6% H2O2 and stained for 1 h with an antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; 40143-R019, 1:300 dilution). Cells were further stained with the secondary antibody anti-rabbit HRP conjugate (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... followed by rabbit monoclonal antibody against SARS-CoV2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Microbiology 2020Quote: ... China) were coated with 2 μg/mL (50μL/well) SARS-CoV-2 Spike Protein (S1 Subunit, His tag) (Sino Biological, China, cat no:40591-V08H) in carbonate bicarbonate buffer pH9.6 and the plates were incubated at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Infected cells were labelled with a mixture of the mouse monoclonal antibody J2 against dsRNA (Scicons, diluted 1:400) and a rabbit polyclonal antibody directed against the spike protein (Sino Biological Inc, diluted 1:500) in PBS supplemented with 5% GS for 30 minutes at room temperature ...
-
bioRxiv - Microbiology 2021Quote: ... followed by rabbit monoclonal antibody against SARS-CoV-2 N protein (1:20,000 dilution x 60 minutes, #40143-R019, Sino Biological US Inc., Wayne, PA, USA), then incubated with Rabbit Envision (Dako ...
-
bioRxiv - Biochemistry 2021Quote: ... or S2-His proteins expressed in HEK293 (S1 and RBD) or insect cells (S2) were used (Sino Biological 40591-V08H, 40592-VNAH, and 40590-V08B). Native mass spectrometry (Olinares et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Tissue sections were incubated overnight at 4°C with primary antibody against the SARS-CoV-2 nucleocapsid protein (1:1000, Sino Biologicals US Inc, Wayne, PA). After washing 3 times with wash buffer ...
-
bioRxiv - Immunology 2023Quote: ... Paraffin blocks containing the left lung lobe were sectioned at approximately 4 microns and stained using hematoxylin and eosin (H&E) or immunostained using a rabbit monoclonal antibody against SARS-CoV-2 nucleocapsid protein (Sino Biological; cat. no. 40588-R002) and rabbit polyclonal antibodies against CD-3 protein (Dako ...
-
bioRxiv - Bioengineering 2023Quote: Nectagen’s nanoCLAMP phage display library NL-21 was panned as described (Suderman et al. 2017) against SARS CoV 2 Spike protein RBD (Sino Biologicals, S1RBD-Fc, cat#40592-VO2H) for rounds 1 and 2 ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were incubated overnight at 4°C with a primary antibody for SARS-CoV-2 (2019-nCoV) S protein (Sino Biological, 40589-T62; diluted 1:2,000 in PBS-T). Next ...