Labshake search
Citations for Sino Biological :
601 - 650 of 689 citations for BD 2 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... of the spike protein (S-RBD) of the SARS-CoV-2 virus (with human Fc as a tag for detection) was purchased from Sino Biological (Beijing).
-
bioRxiv - Bioengineering 2020Quote: ... and SARS-CoV-2 (2019-nCoV) and RBD of spike glycoprotein (mFC tag)(40592-V05H) were purchased from Sino Biological (Beijing, China).
-
bioRxiv - Immunology 2021Quote: ... Cells were stained with an anti-SARS antibody (SARS-CoV/SARS-CoV-2 nucleocapsid antibody, rabbit monoclonal antibody; Sino Biological #40143-R001), diluted to 0.125 μg/mL in 3% BSA/PBS blocking solution for 1 h at room temperature ...
-
bioRxiv - Microbiology 2022Quote: ... the plates were sequentially stained with cross-reactive rabbit anti-SARS-CoV-2 N IgG (Cat. No.: 40143-T62, Sino Biological Inc) as the primary antibody and HRP-conjugated goat anti-rabbit IgG(H+L ...
-
bioRxiv - Microbiology 2022Quote: ... Slides were then incubated with a rabbit polyclonal antibody against SARS-CoV/SARS-CoV-2-nucleoprotein (40143-T62, Sino Biological, Pennsylvania, USA) (1:1000) ...
-
bioRxiv - Immunology 2021Quote: ... isolated splenocytes were cultured with 10 mg/ml recombinant SARS-CoV-2 (2019-nCoV) Spike Protein (S1+S2 ECD, His tag) (Sino biological Europe). Recombinant Ovalbumin [10 mg/ml] served as negative protein control ...
-
Oral delivery of SARS-CoV-2 DNA vaccines using attenuated Salmonella typhimurium as a carrier in ratbioRxiv - Microbiology 2020Quote: ... then proteins were monitored with ECL Western blotting substrate (Pierce) after incubation with anti-SARS-CoV-2-S-RBD (Sino Biological, China) or anti-β-actin antibody (Solarbio ...
-
bioRxiv - Microbiology 2022Quote: ... after mounting slides were deparaffinized and antigen stained in house with a SARS-CoV-2 N specific antibody (Sino Biologicals #40143-R001) at a dilution of 1:30,000 followed by goat anti-rabbit secondary (Vector Labs #BA1000) ...
-
bioRxiv - Microbiology 2020Quote: ... The horses were inoculated subcutaneously with SARS-CoV-2 Spike Protein (S1 Subunit, His tag) (Sino Biological, China, cat no:40591-V08H) antigens containing 1.0mg ...
-
bioRxiv - Microbiology 2020Quote: ... were coated with 8 μg/ml SARS-CoV-2 antigens (spike glycoprotein extracellular or receptor-binding domains, or nucleocapsid: Sino Biological, China) or SARS antigen (spike glycoprotein S1 subunit ...
-
bioRxiv - Immunology 2021Quote: ... the viral nucleocapsid was detected using 1:5000 of SARS-CoV/SARS-CoV-2 Nucleocapsid monoclonal antibody (Sino Biological, Cat#40143-R001) by incubation at 37°C for 1 h ...
-
bioRxiv - Immunology 2021Quote: ... Plates were coated with 1μg/ml of SARS-CoV-2 spike protein (S1+S2 ECD, His tag; Sino Biological, Cat. 40589-V08B1), SARS-CoV-2_DB_his (monomeric RBD ...
-
bioRxiv - Immunology 2022Quote: ... and SARS-CoV-1 pseudotyped virus neutralization assay) or 293T cells overexpressing human angiotensin-converting enzyme 2 (293T-hACE2) (Sino Biological Company) (for Pangolin-GD and RaTG13 pseudotyped virus neutralization assay) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids expressing the SARS-CoV and SARS-CoV-2 S proteins were purchased from Sino Biologicals (catalog # VG40150-G-N; VG40589-CY). Expression of different coronavirus E proteins ...
-
bioRxiv - Immunology 2023Quote: ... each well was transfected with 2 μg eucaryotic recombinant plasmid pCMV3-C-GFPSpark (C-GFPSpark tag, Sino Biological Inc., Cat#VG40608-ACG) encoding the SARS-CoV-2 full-length membrane glycoprotein fused to a green fluorescent protein (GFP) ...
-
bioRxiv - Bioengineering 2023Quote: ... The libraries were subjected to five rounds of biopanning against the recombinant SARS-CoV-2 BA.1 RBD protein (Sino Biological Inc.) as described previously38 ...
-
bioRxiv - Immunology 2023Quote: ... 26.4 pmol His-Tagged Biotinylated SARS-CoV-2 (2019-nCoV) spike RBD Recombinant Protein (Sino Biological Inc.; cat number: 40592-VO8H-B) was firstly incubated for 1 hour with 3.78 pmol Streptavidin Alexa Fluor 647 (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... The S protein expression from cell lysates was analyzed by Western blot using an anti-SARS-CoV-2 RBD polyclonal antibody (Sino Biological, China) and GAPDH as a loading control.
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Full-length DNA clone of Human angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 with C terminal GFPSpark tag (pCMV3-hACE2-GFPSpark) was obtained from Sino biological (#HG10108-ACG). The mammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike ...
-
bioRxiv - Molecular Biology 2021Quote: Codon optimized SARS-CoV-2 (2019-nCoV) Spike S1 Gene with C terminal OFP Spark fluorescent tag (pCMV3-C-OFPSpark) was obtained from Sino biological (#VG40591-ACR). Full-length DNA clone of Human angiotensin I converting enzyme (peptidyl-dipeptidase A ...
-
bioRxiv - Immunology 2021Quote: ... Cells infected with MV-014-212 were stained with primary rabbit anti-SARS-CoV-2 spike protein polyclonal antisera (Sino Biologicals, Beijing, China). The plates were incubated for 1 hour at room temperature with constant rocking ...
-
bioRxiv - Microbiology 2021Quote: An immunohistochemistry (IHC) technique to detect SARS-CoV-2 nucleoprotein (NP) antigen using the rabbit monoclonal antibody (40143-R019, Sino Biological, Beijing, China) at a 1:15,000 dilution ...
-
bioRxiv - Bioengineering 2021Quote: ... was incubated with 5 ng/µl of SARS-CoV-2 (2019-nCoV) Spike S1+S2 ECD-His Recombinant Protein (Sino Biological #40589-V08B1) in phosphate buffer (pH 6.0) ...
-
bioRxiv - Microbiology 2020Quote: ... The SARS-CoV-2 S expression plasmid pC-SARS2-S was created by inserting the Acc65I/NotI-digested PCR-amplified SARS-CoV-2 S fragment of pCMV3-2019-nCoV-Spike(S1+S2)-long (Sino Biological; VG40589-UT) into the corresponding site of pCAGGS ...
-
bioRxiv - Microbiology 2021Quote: ... the 96-well plates were coated overnight at 4°C with 2 µg/mL LRRC15-His or ACE2-His (Sino biological, #10108-H08H). This was followed by blocking with 2% FBS for 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... Potency was assessed using a cell-based immunosorbent assay to quantify infection by detecting the SARS-CoV-2 nucleoprotein using a specific antibody raised against this protein (Sino Biological, Wayne, PA). The secondary antibody (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... anti-S1 neutralizing antibody (Catalog# 40591-MM43, lot HB14AP2001) and anti-S1 non-neutralizing antibody (Catalog # 40591-MM42, lot HB14AP0701) were also purchased from Sino Biological (Vendor #2). S1-Fc (Catalog # 10623-CV ...
-
bioRxiv - Synthetic Biology 2022Quote: ... nanobodies were preincubated with 4 nM SARS-CoV-2 spike protein receptor binding domain fused to an Fc tag (RBD-Fc, SARS-CoV-2 spike protein residues 319-541) (Sino Biological, Wayne, PA) in PBS supplemented with 0.05 mg/mL BSA at 25°C for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... Then 5 000 sorted CXCR4low MKs or CXCR4high MKs were added in the upper inserts and placed onto macrophages chambers for additional 16 hours incubation without or with 2 μg ml−1 TNFα neutralizing antibody (R023, Sino Biological; 1:100) or 2 μg ml−1 IL-6 neutralizing antibody (MP5-20F3 ...
-
bioRxiv - Immunology 2021Quote: ... with 5×105 TCID50 of recombinant MeV-derived vaccine virus in 200 μl volume or subcutaneously (s.c.) with 10 μg recombinant SARS-CoV-2 S protein (Sino Biological Europe, Eschborn, Germany) adjuvanted with 500 μg aluminum hydroxide (Allhydrogel adjuvant 2% ...
-
bioRxiv - Immunology 2021Quote: ... When this was done the mix was marked with rabbit monoclonal antibody anti-SARS-CoV-2 S1 (1:200) (cat. n° 40150-R007, Sino Biological, Beijing, China) as primary antibody for 1h at 37°C ...
-
bioRxiv - Immunology 2021Quote: ... and incubated the monolayer with the rabbit polyclonal antibody specific to SARS-CoV-2 RBD protein (1:200) (cat. n° 40592-T62, Sino Biological, Beijing, China), and a chicken antiserum specific to Newcastle disease virus (1:200 ...
-
bioRxiv - Immunology 2022Quote: ... pre-incubated beads were incubated a second time with 2 µg of a recombinant human DC-SIGN protein with a human Fc tag (Sino Biological, Köln, Germany) for 1 h at 4°C with agitation ...
-
bioRxiv - Pathology 2021Quote: A previously described immunohistochemistry technique to detect SARS-CoV-2 NP antigen 40 using the rabbit monoclonal antibody (40143-R019, Sino Biological, Beijing, China) at dilution 1:1000 ...
-
bioRxiv - Immunology 2020Quote: ... were coated with SARS-CoV-1 RBD-rCD4-His or SARS-CoV-2 RBD-rCD4-His or MERS-CoV S1-His (Sino Biological, 40069-V08H), at 3 μg/mL ...
-
bioRxiv - Biochemistry 2021Quote: ... different concentrations of rat serum (immunized with COVID-eVax vaccine) or anti-SARS-CoV-2 Spike S1 Subunit antibody (Sino Biological, 40150-T62) were added to each well and incubated overnight at 4°C in PBS – 0.05% Tween20 - 1% BSA ...
-
bioRxiv - Immunology 2021Quote: ... HIV-1 PSD and pCMV3 containing the SARS-CoV-2/COVID-19 Spike gene were co-transfected into 7 x 105 293F cells using Sinofection (Sino Biological, Beijing, China). The medium was replaced with fresh DMEM containing 10% FBS after overnight incubation ...
-
bioRxiv - Immunology 2021Quote: ... 1μg of formalin and heat inactivated SARS-CoV 2 adjuvanted in Alhydrogel (Brenntag) 1% or 1.5 μg of recombinant SARS-CoV-2 spike protein (S1+S2 ECD, His tag; Sino Biological, Cat. 40589-V08B1) adjuvanted in Alhydrogel (Brenntag ...
-
bioRxiv - Microbiology 2020Quote: The concentration of the S protein was determined with an ELISA kit (SARS-CoV-2 Spike ELISA kit, Sino Biological Inc., Beijing, China). A monoclonal antibody specific for the S protein of SARS-CoV-2 was pre-coated onto well plates ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were fixed in 3.7% formaldehyde and stained with anti-SARS-CoV-2 polyclonal S1 antibody (Sino Biological, 40591-T62; RRID: AB_2893171) and secondary antibody anti-Rabbit-IgG-FITC (Sigma ...
-
bioRxiv - Immunology 2023Quote: The plasmid pCMV3-2019-nCoV-Spike (S1+S2)-long encodes full-length spike from SARS-CoV-2 amino acid 1–1273 (GenBank accession number YP_009724390 /QHD43416.1) and was obtained from Sino Biological (catalogue number VG40589-UT). This contained codon optimised cDNA for expression of the protein in mammalian cells inserted into the KpnI/XbaI sites of the mammalian expression vector pCMV3-untagged under control of the high-level expression mammalian human enhanced cytomegalovirus (CMV ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were blocked in 5% BSA in TBS + 0.1% Tween-20 (TBST) at room temperature before incubation at 4°C overnight with primary antibodies: SARS-CoV-2 spike RBD (Sino Biological, 40592-T62), GAPDH (BioLegend ...
-
bioRxiv - Cancer Biology 2023Quote: ... INHBA (Cat# 10429, -HNAH), and neuregulin-beta1 (Cat# 11609-HNCH, Ser 2-Lys 246 N-terminal fragment) were all from Sino Biological (Houston, TX). Human NRG1-specific siRNAs (5’-UCGGCUGCAGGUUCCAAAC ...
-
bioRxiv - Cancer Biology 2023Quote: ... (2) VWF-bound gcEVs (VWF+gcEVs) obtained by incubation of gcEVs with 10 µg of recombinant (r) human VWF (Sino Biological, Beijing, China); (3 ...
-
bioRxiv - Immunology 2021Quote: ... 100 μg of recombinant SARS-CoV-2 (2019-nCoV) spike S1 protein (Cat: 40591-V08H and 40591-V08H10, Sino Biological, endotoxin level: <0.001U/μg) was used per dose ...
-
bioRxiv - Immunology 2021Quote: ... were fixed after 48 hrs with 1:1 solution of methanol/ acetone and air-dried prior to immunostaining with rabbit SARS-CoV-2 RBD polyclonal antibody (Cat # 40592-T62; Sino Biological; 1:1000 dilution) and HRP-conjugated anti-Rabbit IgG antibody (1:2000 ...
-
bioRxiv - Immunology 2021Quote: ... blocked with 5% skim milk in PBS-T and incubated with rabbit SARS-CoV-2 RBD polyclonal antibody (Cat # 40592-T62, Sino Biological; 1:1,000 dilution) overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: The pVSV-spike expression plasmid was constructed by PCR amplification of the full length human codon optimized spike gene from pCMV3-SARS-Cov-2 spike expression plasmid (Sino Biological, Cat #VG40588-UT) using the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... The Vero E6 cells were fixed and stained 20 hours (h) after infection and immunostained with a SARS-CoV/SARS-CoV-2 Nucleocapsid monoclonal antibody (Sino Biological, Wayne, PA, USA) followed by a horseradish peroxidase (HRP)-labeled Goat anti-Mouse IgG (cat # G-21040 ...