Labshake search
Citations for Sino Biological :
451 - 500 of 609 citations for Mouse Anti Dengue Virus Pan Serotype NS1 Antibody DA034 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2022Quote: ... Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: Antibody was tested by indirect ELISA with the SARS-CoV-2 RBD protein (Sino Biological Inc., China) and peroxidase conjugated goat anti-cat IgG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies Nucleocaspid protein SARS-CoV-2 (1:200, 40143-MM05, Sino Biological) and cardiac troponin T (1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Immunology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral nucleocapsid was stained with rabbit anti-NP (1:500; Sino biological), ciliated cells were stained with anti-AcTub (1:100 ...
-
bioRxiv - Microbiology 2020Quote: ... or rabbit-anti-SARS-CoV nucleoprotein (40143-T62, 1:400, Sino biological). Tight junctions were stained using mouse-anti-ZO1 (ZO1-1A12 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS and stained with rabbit anti-nucleocapsid (Sino biological; 1:2000) in PBS containing 0.1% BSA ...
-
bioRxiv - Microbiology 2020Quote: ... Positive control for the nucleocapsid ELISA was SARS-CoV nucleoprotein rabbit monoclonal antibody (Sino Biological Inc, Beijing, China). Negative controls were reagent grade human sera (compared to Mab CR3022) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primary antibodies were used to stain the SARS-CoV-2 Nucleoprotein (N; Sino Biological #40143-R019, 1:8000) and Spike protein (S ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h ...
-
bioRxiv - Microbiology 2019Quote: ... S protein was detected using the MERS-CoV S rabbit polyclonal antibody (Sino Biological, Cat No: 40069-RP01) as the primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 were obtained from Sino Biological (Wayne ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of SARS-CoV-2 Spike antigen rabbit SARS-CoV Spike S1 antibody (40150-RP01, Sino Biological) and rabbit SARS-CoV Spike primary antibody (40150-T62-COV2 ...
-
bioRxiv - Biochemistry 2019Quote: ... the PVDF membrane was incubated the primary antibodies against Tf (1:2000, 11019-RP02, Sino Biological Inc., China) at 4°C overnight ...
-
bioRxiv - Immunology 2020Quote: ... Fixed and permeabilized cells were first stained with a primary antibody recognizing SARS-CoV nucleocapsid protein (Sino Biological), followed by secondary antibody staining with AlexaFluor 488-conjugated goat anti-rabbit antibody ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 N (1:1000 dilution, SARS-CoV-2 Nucleocapsid Antibody, Rabbit MAb, #40143-R019, Sino Biological), and GAPDH (1:1000 dilution ...
-
bioRxiv - Immunology 2021Quote: ... 2 uG of each antibody was separately cross-linked to 2 uG of the Spike protein (Sino Biological Inc ...
-
bioRxiv - Microbiology 2023Quote: ... Primary antibody incubation was conducted for 3 hours at room temperature (1:2,000 α-N protein, Sino Biological 40143-R001 ...
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 nucleoprotein was detected by immunohistochemistry (IHC) using the rabbit monoclonal antibody (40143-R019, Sino Biological) at a 1:15000 dilution ...
-
bioRxiv - Microbiology 2020Quote: ... The cells were incubated with anti-S protein Rab (Sino Biological, PA, USA) at 1:1000 in the blocking solution overnight at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... rabbit anti-SARS-Cov-2 spike S2 (Sino Biological #40590-T62, 1:1000), rabbit anti-β-actin (proteintech #20536-1-AP ...
-
bioRxiv - Bioengineering 2022Quote: ... or anti-hCoV HKU1 spike monoclonal Ab (mAb) (40021-MM07-100, Sino Biological) diluted 1:1000 in TBS with 0.1% Tween 20.
-
bioRxiv - Pathology 2022Quote: ... Rabbit anti-SARS-CoV-2 Spike S (1:200, Sino Biological, 40150-R007), Goat anti-ACE2 (1:100 ...
-
bioRxiv - Microbiology 2021Quote: ... Foci were stained with 50μl/well rabbit anti-nucleocapsid (Sino Biological, 40588-T62) diluted 1:1000 in 0.2% (w/v ...
-
bioRxiv - Bioengineering 2020Quote: ... Bound phage were detected by incubation with anti-M13-HRP conjugate (Sino Biological)(1:5000 ...
-
bioRxiv - Biochemistry 2022Quote: ... Anti-HA murine mAb (Cat. No. 100028-MM10) was purchased from Sino Biologicals US Inc ...
-
bioRxiv - Microbiology 2022Quote: ... transferred to PVDF membranes and immunoblotted with anti-S1 (Sino Biological, 40150-T62), anti-S2 (Sino Biological ...
-
bioRxiv - Neuroscience 2022Quote: ... such as rabbit anti-FcγRI (1:500, Cat: 80016-R015, Sino Biological Inc.), goat anti-FcRγ (1:100 ...
-
bioRxiv - Systems Biology 2023Quote: ... blocked with 5 % BSA stained with primary anti-NP (Sino Biological 40143-R001), and secondary goat anti-rabbit IgG conjugated to Alexa Fluor 488 (Thermo Fisher Scientific A-11034) ...
-
bioRxiv - Immunology 2023Quote: ... Keytruda-biosimilar (anti-PD1(MK)-IgG4) was purchased from Sino Biological (Beijing, China). B7-H1-Fc (PD-L1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rabbit polyclonal anti-SARS-CoV-2 nucleoprotein N protein (40068-RP01; Sino Biological) and anti-actin (L00003 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were washed and incubated in primary conjugated antibodies (EZH2, BD Bioscience; CD133, Miltenyi; CD15, Biolegend; Sox2, Sino Biological Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... polyclonal antibodies against SARS-CoV RP01 (Cat: 40150-RP01) and T52 (Cat: 40150-T52) were purchased from Sino Biological. Fetal bovine serum (FBS ...