Labshake search
Citations for Sino Biological :
451 - 500 of 619 citations for Mouse Anti Canine Coronavirus Nucleoprotein Antibody M700 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... C5aR1−/− and C5aR2−/− mice on a C57BL/6J genetic background (n=5-15) were administered with recombinant mouse C5a (Sino Biological, China) at a dose of 50 μg kg-1 via intravenous injection (tail vein) ...
-
bioRxiv - Immunology 2020Quote: Internalization of CCR7 was also examined with HEK293T cells stably expressing a mouse CCR7-GFP fusion construct (pCMV3-mCCR7-GFPSpark, Sino Biological Inc.). HEK293T cells were transfected with CCR7-GFP with Lipofectamin 2000 (Gibco) ...
-
bioRxiv - Bioengineering 2023Quote: ... Cells were grown till 70-80% confluency and then treated for 48 hours with 1 μM recombinant mouse interferon gamma (Sino Biological, China). Treated cells were detached by trypsinisation and stained with antibodies against the MHC cell surface proteins.
-
bioRxiv - Neuroscience 2023Quote: Pyk2 activity was assessed through its autophosphorylation level and capacity to phosphorylate recombinant mouse his-GST-Src (Sino Biological Inc, Chesterbrook, PA). For autophosphorylation ...
-
bioRxiv - Microbiology 2022Quote: ... immunohistochemistry with a monoclonal antibody detecting SARS-CoV/SARS-CoV-2 nucleocapsid (Sino Biological 40143-MM05) was performed on FFPE tissue sections ...
-
bioRxiv - Immunology 2020Quote: ... Binding analysis of captured murine IgG antibodies to S1-His or RBD-His (Sino Biological Inc.) was performed using a multi-cycle kinetic method with concentrations ranging from 25 to 400 nM or 1.5625 to 50 nM ...
-
bioRxiv - Microbiology 2021Quote: ... a monoclonal antibody directed against the spike protein of SARS-CoV-2 (1:1,500, Sino Biological) was detected with a peroxidase-conjugated anti-rabbit secondary antibody (1:1,000 ...
-
bioRxiv - Immunology 2020Quote: ... and then incubated with the antibody against CD14 (1:200 dilution, 10073-RP0, Sino Biological, China) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... for MVA/S and rabbit SARS-CoV-2 RBD polyclonal antibody (Cat# 40592-T62, Sino Biological) for MVA/S1 diluted 1:2500 in blocking buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Rabbit polyclonal against SARS-CoV-2 N protein antibody was purchased from Sino Biological (Beijing, China). Alexa Fluor 488-conjugated goat anti-mouse IgG ...
-
bioRxiv - Microbiology 2022Quote: ... Primary antibody to SARS-CoV-2 spike subunit 1 (Sino Biological, Beijing, Cat. No. 40589-T62), was diluted 1:25 in blocking solution and grids were transferred to drops of primary antibody for 30 minutes ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated with a rabbit (2019-nCoV) S1 antibody (1:50; Sino Biological, Duesseldorf, Germany) and then incubated for 1 hour at 37°C with secondary goat anti-rabbit antibodies conjugated with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Immunology 2021Quote: ... an anti-SARS-CoV-2 RBD mAb (40150-D004, Sino Biological) and anti-SARS-CoV-2 nucleocapsid antibody (MBS2563841 ...
-
bioRxiv - Molecular Biology 2019Quote: ... and anti-Tf (1:2000, 11019-RP02, Sino Biological Inc, China) antibodies ...
-
bioRxiv - Immunology 2021Quote: ... Rabbit anti-SARS-CoV-2 spike (Sino Biological Inc, Beijing, China) was diluted in iBind solution (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-SARS-CoV-2 Spike S1 (Sino Biological, # 40150-R007) and rabbit anti-TMPRSS2 (Atlas Antibodies ...
-
bioRxiv - Molecular Biology 2021Quote: ... and rabbit anti-MERS S1 (1:200; 40069-T52, Sino Biological). For immunofluorescence ...
-
bioRxiv - Bioengineering 2022Quote: ... rabbit anti-SARS-CoV-2 spike pAb (Sino Biological, 40592-T62), or anti-hCoV HKU1 spike monoclonal Ab (mAb ...
-
bioRxiv - Immunology 2020Quote: ... anti-TGF-β1 (1:1□000, 50698-T48, Sino Biological, China), anti-IL-10 (1:1□000 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The cells were incubated with anti-Spike protein Rab (Sino Biological) at 1:1000 in blocking solution overnight at 4°C ...
-
bioRxiv - Immunology 2021Quote: ... rabbit anti-C1-INH (1 µg/mL, Sino Biologicals, 10995-R018) or rabbit anti-human C1q (1:300) ...
-
bioRxiv - Microbiology 2022Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2023Quote: ... Membranes were probed with anti-S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Microbiology 2022Quote: ... cells were incubated with anti-ACE2 (Sino Biological, 10108-RP01-100) or isotype control (Cell Signaling Technology ...
-
bioRxiv - Microbiology 2023Quote: ... anti-SARS-CoV-2-Spike (Sino Biological, 40592-MM117, 1:2000), anti-MERS-CoV-Spike (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: ... recombinant SARS-CoV-2 RBD fusion protein with the Fc region of mouse IgG1 at the C-terminus (RBD-Fc) was purchased from Sino Biological (Beijing, China), recombinant SARS-CoV-2 RBD with a C-terminal His-tag was purchased from Kactus Biosystems (Shanghai ...
-
bioRxiv - Microbiology 2023Quote: ... groups of five 8-to-12-week C57B6 mice (Taconic Farms Inc) were immunized with 4 μg/mouse of HCoV-OC43 S-His (Sino Biological # 40607-V08B) or N-His protein (Sino Biological # 40643-V07E ...
-
bioRxiv - Immunology 2022Quote: ... Infected cells were detected using a primary detection antibody recognizing SARS-CoV-2 nucleocapsid protein (Sino Biological) following staining with secondary detection antibody (goat α-rabbit ...
-
bioRxiv - Microbiology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Microbiology 2021Quote: ... Immunofluorescence experiments were performed using SARS-CoV and SARS-CoV-2 Spike antibody (40150-R007, Sino Biologicals) and Alexa-488 conjugated anti-rabbit secondary antibody (Invitrogen).
-
bioRxiv - Microbiology 2020Quote: ... Sections were then incubated with rabbit polyclonal antibody against SARS-CoV S (Sino Biological, #40150-T62-COV2) at dilution 1:500 and mouse monoclonal antibody against SARS-CoV NP (Sino Biological ...
-
bioRxiv - Microbiology 2020Quote: Antibody was tested by indirect ELISA with the SARS-CoV-2 RBD protein (Sino Biological Inc., China) and peroxidase conjugated goat anti-cat IgG (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were stained with primary antibodies Nucleocaspid protein SARS-CoV-2 (1:200, 40143-MM05, Sino Biological) and cardiac troponin T (1:400 ...
-
bioRxiv - Microbiology 2022Quote: ... purified SARS-CoV-2 spike-specific monoclonal rabbit primary antibody R001 (Cat. n° 40592-R001, Sino Biological).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 (2019-nCov) rabbit polyclonal spike neutralizing antibody from Sino Biological (cat no. 40592-R001) was used at 3 µM working concentration ...
-
bioRxiv - Immunology 2020Quote: ... which consists of a commercially available chimeric monoclonal SARS-CoV-2 S1 antibody (Sino Biologicals, Beijing, China) spiked into plasma from non-COVID-19 donors at levels intended to give titers similar to those found in plasma of COVID-19 donors.
-
bioRxiv - Immunology 2021Quote: ... Specific staining was detected using SARS-CoV/SARS-CoV-2 nucleocapsid antibody (Sino Biological cat#40143-MM05) at a 1:1000 dilution ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1A10 were prepared by immunizing BALB/c mice with recombinant SARS-CoV-2 RBD fused with a C-terminal mouse IgGFc tag (Sino Biological Inc, Beijing, China) using previously described protocols (Qu et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Microbiology 2022Quote: ... Anti-SARS-CoV-2 spike protein (Sino Biological, Beijing, China, 1:200). LDs were stained using OIL Red R (1:5000 diluted in water ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-Lipocalin-2/LCN2 (1:500, 50060-RP02; Sino Biological, China), mouse anti-NF200 (1:500 ...
-
bioRxiv - Microbiology 2022Quote: ... anti-SARS-CoV-2 N (1:1000, MA14AP1502, Sino Biological, Beijing, China) anti-P62 (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... Viral nucleocapsid was stained with rabbit anti-NP (1:500; Sino biological), ciliated cells were stained with anti-AcTub (1:100 ...
-
bioRxiv - Immunology 2021Quote: ... The membranes were probed with anti-spike Ab (40150-T62, Sino Biological) and anti-beta-actin Ab (A4700 ...
-
bioRxiv - Microbiology 2022Quote: ... in PBS and stained with rabbit anti-nucleocapsid (Sino biological; 1:2000) in PBS containing 0.1% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The spike expression was detected using the SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... cells were incubated with a primary antibody targeting SARS-CoV-2 nucleocapsid protein (Sino Biological, cat. 40143-R001) at a 1:2000 dilution for 1h ...
-
bioRxiv - Microbiology 2019Quote: ... S protein was detected using the MERS-CoV S rabbit polyclonal antibody (Sino Biological, Cat No: 40069-RP01) as the primary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... The spike expression was detected using a SARS-CoV-2 spike antibody (Cat: 40591-T62, Sino Biological Inc.) at 1/500 dilution for 1 hour ...
-
bioRxiv - Microbiology 2022Quote: The SARS-CoV-2 spike-specific monoclonal rabbit primary antibodies R001 and R007 were obtained from Sino Biological (Wayne ...