Labshake search
Citations for Sino Biological :
1 - 50 of 1912 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: Spike S1-Fc (Sino Biological, China, 40591-V02h, 6.25 ng/mL) was mixed with ACE2-Fc (Sino Biological ...
-
bioRxiv - Cell Biology 2024Quote: ... For reconstitution of PACT (MG52537-NF) cDNA clone expression plasmid was purchased from Sino Biologicals. The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... was mixed with ACE2-Fc (Sino Biological, China, 10108-H02H, 50 ng/mL) or Human IgG-Fc (Sino Biological ...
-
bioRxiv - Cell Biology 2024Quote: ... or Human IgG-Fc (Sino Biological, China, 10702-HNAH, 50 ng/mL) at 4 °C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... The mixture was then added with a series of concentrations (0, 6.25, 12.5, 25, 50 ng/mL) of BTN3A2-His (Sino Biological, China, 13515-H08H). These sample series were transferred to a plate pre-coated with the spike glycoprotein S1-RBD from SARS-CoV-2 (Elabscience ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Immunology 2024Quote: ... ELISA plates were coated with 200 ng of recombinant SARS-CoV-2-S1WU protein (Sino Biological) or SARS-CoV-2-S1RS09OM protein per well and incubated overnight at 4°C in carbonate coating buffer (pH 9.5 ...
-
bioRxiv - Developmental Biology 2024Quote: ... anti NGFR/p75NTR polyclonal antibody (Sino Biological, Cat No. 102002-T34, 1:2000 dilution), anti p53 monoclonal antibody (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... EG.5.1 and JN.1 (Sino Biological). ELISA plates (Corning ...
-
bioRxiv - Immunology 2024Quote: ... The plates were incubated with biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological, 1 μg/ml) for 2 h and Streptavidin-AP Conjugate from Invitrogen (1.5 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological), SARS-CoV-2 (JN.1 ...
-
bioRxiv - Immunology 2024Quote: ... SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological) labeled with DyLight 405 ...
-
bioRxiv - Microbiology 2024Quote: ... Blots were probed with polyclonal anti-SARS-CoV-2 S1 (Sino Biological, 40591-T62; RRID:AB_2893171), anti-S2 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... RBD (K417N/ WT/ Omicron BA.1) (Sino Biologicals) or streptavidin (catalogue #434302 ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 100 ng/well of SARS-CoV-2 (2019-nCOV) Spike S1 + S2 ECD-His-Recombinant Protein (40589-V08B1, Sino Biological) overnight at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... The WH-1 spike trimer (Sino Biological, cat. 40589-V08H4) was used as the antigen in all ELISAs at a concentration of 1μg/mL overnight at 4°C and blocked with 3% BSA in wash buffer for one hour at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BQ.1.1 (Sino Biological, cat. 40589-V08H41), SARS-CoV-1 (Acro Biosystems ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.2 (Sino Biological, cat. 40589-V08H28), Omicron BA.4/BA.5 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... to capture the nucleocapsid protein using a rabbit anti-SARS-CoV-2 nucleocapsid antibody (Sino Biological) followed by a goat anti-rabbit antibody conjugated with APC (Abcam) ...
-
bioRxiv - Immunology 2024Quote: ... The spike subdomain proteins were SARS-CoV-2 S1 (Sino Biological, cat. 40591-V08H), SARS-CoV-2 S2 (insect cell derived ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.4/BA.5 (Sino Biological, cat. 40589-V08H32), Omicron XBB (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.1 (Sino Biological, cat. 40589-V08H26), Omicron BA.2 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... The recombinant spike trimers used in these assays were as follows: Wuhan-Hu-1 (Sino Biological, cat. 40589-V08H4), Delta (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Delta (Sino Biological, cat. 40589-V08H10), Omicron BA.1 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Omicron XBB (Sino Biological, cat. 40589-V08H40), Omicron BQ.1.1 (Sino Biological ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... A SARS-CoV-2 spike neutralizing antibody (Sino Biological Inc. ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... The anti-SARS-CoV-2 (2019-nCoV) Spike RBD-mFc clone #57 used as a control for neutralization assays was acquired from Sino Biologicals.
-
bioRxiv - Immunology 2024Quote: ... 50 ng S-RBD recombinant protein (Sino Biologicals) in coating buffer (15mM sodium carbonate ...
-
bioRxiv - Immunology 2024Quote: ... of S protein) and recombinant S protein (Sino Biological) were used for stimulation at a final concentration of 2 μg/mL ...
-
bioRxiv - Immunology 2024Quote: ... or S recombinant protein (Sino Biological) at a final concentration of 1 μg/mL for 6 hours incubation in a 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Cells were then stained with polyclonal anti-SARS-CoV-2 S1 antibody (Sino Biological, 40591-T62; RRID: AB_2893171) followed by anti-Rabbit-IgG-FITC (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... anti-S2 (Sino Biological, 40590; RRID:AB_2857932), anti-p24 (NIH HIV Reagent Program ...
-
bioRxiv - Immunology 2024Quote: ... and plaques stained with a polyclonal rabbit anti-SARS-CoV-2 nucleocapsid antibody (Sino Biological) and a secondary peroxidase-labelled goat-anti rabbit IgG antibody (Dako) ...
-
bioRxiv - Immunology 2024Quote: Nucleocapsid and Spike Glycoproteins expressed in HEK cells were purchased from Sino biological (Cat Numbers ...
-
bioRxiv - Immunology 2024Quote: ... and commercially obtained ancestral SARS-CoV-2 RBD (Bio-Techne) and NTD (Sino Biological) subunits ...
-
bioRxiv - Immunology 2024Quote: ... The different antigens were acquired from Sino biological (Wayne, PA).
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with EGF (Sino biological, Cat# 10605-HNAE), bFGF (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mice were intranasal inoculation of 0.1mg/kg BSA or sTREM2 protein (Sino Biological, China) in total volume of 10 μL under anesthesia ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:1000), anti-β-tubulin (ab6046 ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Neuroscience 2024Quote: ... 200 ng or the indicated amount of human recombinant PGRN (rPGRN, # 10826-H08H, Sino Biological Inc.) was either added to the activation assay or to the activity assay.
-
bioRxiv - Microbiology 2024Quote: ... The transfected cells were cultured in SMM 293-TIS Expression Medium (Serum-free, without L-Glutamine) (Sino Biological). The supernatant ...
-
bioRxiv - Microbiology 2024Quote: ... and treated with anti-SARS-CoV-2 Nucleocapsid (N) antibody (catalogue no. 40143-MM05; Sino Biological) at 1:1000 for one hour at 37 ℃ ...
-
bioRxiv - Cell Biology 2024Quote: Mouse RBM7 cDNA constructs were cloned using a full-length mouse pUC[mRBM7] cDNA plasmid (Sino Biological, MG5399-U) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:200), or anti-HA (H3663 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and anti-mouse CD142 (Sino Biological, 50413-R001 ...
-
bioRxiv - Developmental Biology 2024Quote: The I-BAR domain of human Mtss1 was purchased from Sino Biological (Cat 13085-H10E). The human Plexin-D1 cytosolic domain was prepared ...
-
bioRxiv - Cell Biology 2024Quote: ... pCMV3-hIDO1-FLAG (Sino Biologicals # HG11650-CF) as required ...
-
bioRxiv - Molecular Biology 2024Quote: ... then inserted into pCMV3-C-GFPSpark® backbone (Sino Biological, HG22790-ACG) (PCR amplification with primers listed in Table S3 ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-Spike antibody (Sino Biological; 40591-MM42), respectively.