Labshake search
Citations for Sino Biological :
1 - 50 of 1996 citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: Nucleocapsid and Spike Glycoproteins expressed in HEK cells were purchased from Sino biological (Cat Numbers ...
-
bioRxiv - Cell Biology 2024Quote: ... or the control IgG antibody (Cat# CR1, Sino Biological Inc.) in an IP spin column at 40 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... then inserted into pCMV3-C-GFPSpark® backbone (Sino Biological, HG22790-ACG) (PCR amplification with primers listed in Table S3 ...
-
bioRxiv - Microbiology 2024Quote: ... were cultured in the serum-free SMM 293-TI medium (Sino Biological Inc.) at 37 °C with 8% CO2 on an orbital shaker platform ...
-
bioRxiv - Cell Biology 2024Quote: ... IP complexes were sequentially eluted first with 50 ul of 1 mg/ml HA peptide (Sino Biological, catalog #PP100028, lot #IP15MA1401X) then boiling in sample buffer 95°C for 10 minutes.
-
bioRxiv - Bioengineering 2024Quote: ... recombinant human IL-15Rbeta/gamma Heterodimer Protein (Sino Biological, Beijing, China), N-803 (Sino Biological ...
-
bioRxiv - Bioengineering 2024Quote: Peripheral blood mononuclear cells (PBMCs) were suspended in ImmunoCult™-XF T Cell Expansion Medium supplemented with 10 μg/ml CD3Ab (OKT3, obtained from Sino Biological, Beijing, China). Subsequently ...
-
bioRxiv - Bioengineering 2024Quote: ... and 2 ng/ml GM-CSF (Sino Biological, Beijing, China). Human peripheral blood mononuclear cells (PBMCs ...
-
bioRxiv - Bioengineering 2024Quote: ... N-803 (Sino Biological, Beijing, China), Anti-Human IgG-Fc Secondary Antibody (Sino Biological ...
-
bioRxiv - Bioengineering 2024Quote: ... CD3Ab OKT3 (Sino Biological, Beijing, China), Human IFN-gamma Quantikine ELISA Kit (R&D systems ...
-
bioRxiv - Bioengineering 2024Quote: ... Anti-Human IgG-Fc Secondary Antibody (Sino Biological, Beijing, China), ELISA basic kit (Multi Science ...
-
bioRxiv - Molecular Biology 2024Quote: ... Rabbit polyclonal anti-SARS-CoV-2 nucleoprotein N protein (40068-RP01; Sino Biological) and anti-actin (L00003 ...
-
bioRxiv - Cell Biology 2024Quote: ... a mouse monoclonal antibody against the SARS-CoV-2 nucleocapsid protein (SARS-CoV-2-N, Sino Biological, 40143-MM05) was used5 ...
-
bioRxiv - Biochemistry 2024Quote: ... coli (our present work) or HEK293 cells (from Sino Biological) was added (50 μl/well) ...
-
bioRxiv - Biochemistry 2024Quote: ... Full-length monoclonal antibodies (mAb) and antibody fragments (Fab) were produced recombinantly in human cells by Sino Biological (Wayne, PA). Fabs were made from mAbs by papain protease digestion ...
-
bioRxiv - Bioengineering 2024Quote: ... The two gene fragments were ligated using NheI and then ligated into pCMV (Sino Biological) using KpnI and NheI ...
-
bioRxiv - Bioengineering 2024Quote: ... anti-spike S1 (MM42) antibody was obtained from Sino Biological (Cat#40591-MM42), anti-spike S2 (1A9 ...
-
bioRxiv - Bioengineering 2024Quote: The SARS-CoV-2 Delta (B.1.617.2) variant spike ELISA kit (Cat#KIT40591A; Sino Biological US Inc) was according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.125 ng/mL EGF (Sino Biological), 5 μg/mL insulin (Sigma) ...
-
bioRxiv - Cell Biology 2024Quote: ... and anti-Spike antibody (Sino Biological; 40591-MM42), respectively.
-
bioRxiv - Cell Biology 2024Quote: ... make up to 100mL with MCDB (Sigma-#M6770)] with 100ng/mL Activin (Sino Biological-#10429) and 14μg/mL CHI99021 (Tocris-#4423) ...
-
bioRxiv - Cell Biology 2024Quote: ... make up to 100mL with MCDB] with 100ng/mL Noggin (Sino Biological-#10267), 50ng/mL KGF ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mice were intranasal inoculation of 0.1mg/kg BSA or sTREM2 protein (Sino Biological, China) in total volume of 10 μL under anesthesia ...
-
bioRxiv - Neuroscience 2024Quote: ... site directed mutagenesis was performed with primer set (forward: CATTGCCAAGGCTCTGCAGTCCATTGG; reverse: CTTCCGGTGGACTCATCT) using the full-length mouse Aldoa cDNA (Sino Biological Cat# MG52539-U) and Q5 Site-Directed Mutagenesis kit (New England Biolabs Cat# E0554S) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and MERS-CoV S2 subdomains as well as recombinant HCoV-NL63 and HCoV-229E S were purchased from Sino Biological.
-
bioRxiv - Immunology 2024Quote: ... 50ug of CD19 protein (Sino Biological #11880-H02H) was reconstituted in 90μl water and 10μl of modifier was added to the protein solution ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with EGF (Sino biological, Cat# 10605-HNAE), bFGF (Gibco ...
-
bioRxiv - Molecular Biology 2024Quote: ... Glass coverslips (24 × 60 mm) were coated with human recombinant Fas protein (50 μg/mL, Sino Biological) at a defined area (10 × 10 mm) ...
-
bioRxiv - Immunology 2024Quote: ... SARS-CoV-2 (2019-nCoV) spike RBD protein (Sino Biological) labeled with fluorescein isothiocyanate (FITC ...
-
bioRxiv - Neuroscience 2024Quote: ... and NGF were acquired from Sino Biological (China) or Absin (China) ...
-
bioRxiv - Microbiology 2024Quote: ... SARS-CoV-2 Nucleocapsid (Sino Biological # 40588-T62 ...
-
bioRxiv - Microbiology 2024Quote: ... the cells were incubated at an OD600 of 8/mL in FACS staining buffer (washing buffer + 0.5 mg/mL of Bovine Serum Albumin) with 9.09 nM hACE2-muFc (Sino Biological) for 1h ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-CD147/basigin (10186-R125, Sino Biological, dilution 1:1000), anti-β-tubulin (ab6046 ...
-
bioRxiv - Cell Biology 2024Quote: Spike S1-Fc (Sino Biological, China, 40591-V02h, 6.25 ng/mL) was mixed with ACE2-Fc (Sino Biological ...
-
bioRxiv - Cell Biology 2024Quote: ... For reconstitution of PACT (MG52537-NF) cDNA clone expression plasmid was purchased from Sino Biologicals. The WT PACT expression vector was used as template for constructing p38 mutant PACT clone by using Q5 site-directed mutagenesis kit (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: ... was mixed with ACE2-Fc (Sino Biological, China, 10108-H02H, 50 ng/mL) or Human IgG-Fc (Sino Biological ...
-
bioRxiv - Cell Biology 2024Quote: ... or Human IgG-Fc (Sino Biological, China, 10702-HNAH, 50 ng/mL) at 4 °C overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... The mixture was then added with a series of concentrations (0, 6.25, 12.5, 25, 50 ng/mL) of BTN3A2-His (Sino Biological, China, 13515-H08H). These sample series were transferred to a plate pre-coated with the spike glycoprotein S1-RBD from SARS-CoV-2 (Elabscience ...
-
bioRxiv - Cell Biology 2024Quote: ... The expression vector for the SARS-CoV-2 Spike protein (pCMV3-2019-nCoV-Spike (S1+S2)-long) was purchased from Sino Biological (VG40589-UT, China). The expression vector for ACE2 was purchased from Miaolinbio (pEnCMV-ACE2 (human)-3×FLAG ...
-
bioRxiv - Immunology 2024Quote: ... EG.5.1 and JN.1 (Sino Biological). ELISA plates (Corning ...
-
bioRxiv - Immunology 2024Quote: ... The plates were incubated with biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological, 1 μg/ml) for 2 h and Streptavidin-AP Conjugate from Invitrogen (1.5 μg/ml ...
-
bioRxiv - Immunology 2024Quote: ... biotinylated SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological), SARS-CoV-2 (JN.1 ...
-
bioRxiv - Immunology 2024Quote: ... SARS-CoV-2 (JN.1) spike RBD protein (Sino Biological) labeled with DyLight 405 ...
-
bioRxiv - Immunology 2024Quote: ... The spike subdomain proteins were SARS-CoV-2 S1 (Sino Biological, cat. 40591-V08H), SARS-CoV-2 S2 (insect cell derived ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.4/BA.5 (Sino Biological, cat. 40589-V08H32), Omicron XBB (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Omicron BA.1 (Sino Biological, cat. 40589-V08H26), Omicron BA.2 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... The recombinant spike trimers used in these assays were as follows: Wuhan-Hu-1 (Sino Biological, cat. 40589-V08H4), Delta (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Delta (Sino Biological, cat. 40589-V08H10), Omicron BA.1 (Sino Biological ...
-
bioRxiv - Immunology 2024Quote: ... Omicron XBB (Sino Biological, cat. 40589-V08H40), Omicron BQ.1.1 (Sino Biological ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... A SARS-CoV-2 spike neutralizing antibody (Sino Biological Inc. ...