Labshake search
Citations for New England Biolabs :
651 - 700 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Samples were then purified using the DNA cleanup column kit (the Monarch PCR & DNA cleanup kit from NEB). The specificity of AlkB repair reaction was confirmed using an inactive AlkB control reaction in which Fe2+ ...
-
bioRxiv - Biophysics 2021Quote: ... Indel frequencies at the SaCas9 target site were assessed via a T7E1 assay with the EnGen Mutation Detection Kit (NEB), using the manufacturer’s recommendations ...
-
bioRxiv - Biochemistry 2021Quote: ... The LAMP reaction in the 2-step LAMP-CRISPR detection was performed using the WarmStart® LAMP Kit (NEB #E1700), using primer concentration described in literature (“Rapid Detection of SARS-CoV-2 Using Reverse transcription RT-LAMP method,” 2020) ...
-
bioRxiv - Microbiology 2020Quote: ... The LPMO and CBH1 amplicons for detection were radio-labelled with [α-32P] dCTP using the NEBlot Kit (NEB, USA) according to the manufacturer’s instructions and used as a probe to determine the copy number of T-DNA integrations in all the transformants.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was subsequently sent for either library preparation and RNA-sequencing to Genewiz or cDNA preparation via a two-step process beginning with Lunascript RT Supermix Kit (#E3010, New England Biolabs). qRT-PCR was performed on cDNA from samples for genes of interest using the Luna Universal qPCR Master Mix (#M3003 ...
-
bioRxiv - Microbiology 2021Quote: ... Official CDC SARS-CoV-2 N1 gene primers and TaqMan probe set were used [58] with the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs):
-
bioRxiv - Molecular Biology 2021Quote: ... The mRNA abundance levels were determined using 200 ng total RNA for each sample in technical replicates using Luna Universal One-Step RT-qPCR kit (New England BioLabs) and SYBR Green as detection agent and gene-specific primers (Table S2) ...
-
bioRxiv - Genomics 2020Quote: Synthetic SARS-CoV-2 RNA templates were serially diluted and amplified by RT-LAMP using the WarmStart LAMP Kit (NEB). LAMP primers were added to a final concentration of 0.2µM for F3 and B3 ...
-
bioRxiv - Pathology 2021Quote: ... β-ENaC/SCNN1B (Hs00165722_m1) and γ-ENaC/SCNN1G (Hs00168918_m1) were performed with the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006L). Expression of each gene was normalized to 18S (Hs99999901_s1) ...
-
bioRxiv - Bioengineering 2020Quote: ... We performed assays for the E and RNase P genes separately in 20 μL reaction volumes using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs). The final concentrations of primer and probe were 400 and 200 nM ...
-
bioRxiv - Microbiology 2021Quote: ... qRT-PCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (EV Table 1 ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... PCR was carried out in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 N-specific primers (Forward 5′-TAA TCA GAC AAG GAA CTG ATT A-3′ ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... 5′-TAATCAGACAAGGAACTGATTA-3′ (Forward) and 5′-CGAAGGTGTGACTTCCATG-3′ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler or an Applied Biosystems StepOnePlus system ...
-
BRD2 inhibition blocks SARS-CoV-2 infection by reducing transcription of the host cell receptor ACE2bioRxiv - Cell Biology 2021Quote: ... were amplified in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler ...
-
bioRxiv - Biochemistry 2021Quote: ... 5’-TAATCAGACAAGGAACTGATTA-3’ (Forward) and 5’-CGAAGGTGTGACTTCCATG-3’ (Reverse) were used with the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) in an Applied Biosystems QuantStudio 6 thermocycler ...
-
bioRxiv - Bioengineering 2021Quote: ... RNA was purified using the Macherey Nagel RNA extraction kit following manufacturer’s instruction and viral RNA uptake was quantified using the Luna universal One-Step RT-qPCR kit (NEB; E3005).
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 RNA levels were quantified with 250 ng of RNA inputs using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs), using real-time RT-PCR primer/probe sets 2019-nCoV_N1 (CDCN1 ...
-
bioRxiv - Microbiology 2021Quote: ... PCR was carried out in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) with SARS-CoV-2 NP-specific primers (Forward 5’-TAA TCA GAC AAG GAA CTG ATT A-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was then diluted to 20 ng/uL and 20-60 ng of RNA was used for qPCR using Luna universal one-step RT-qPCR kit (NEB) as per manufacture’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Samples included 1) cDNA generated from >200nt RNA extracted previously from the 12h embryo sample (LunaScript RT Mastermix Kit, New England Biolabs). 2 ...
-
bioRxiv - Immunology 2022Quote: ... and nCoV_IP4-14084Probe(+) TCATACAAACCACGCCAGG [5’]Hex [3’]BHQ-1 19) and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR reactions were carried out using LightCycler 96 instrument and following reagents: Luna Universal One-Step RT-qPCR Kit (New England Biolabs, NEB) for hCoV-229E and hCoV-OC43 ...
-
bioRxiv - Physiology 2021Quote: ... RNA (0.5-1 μg) was reverse-trancribed to cDNA using LunaScript RT SuperMix Kit (New England Biolabs, Ipswich, MA, USA). TaqMan gene expression assays with FAM-labeled probes were purchased from ThermoFisher Scientific (Carlsbad ...
-
bioRxiv - Microbiology 2020Quote: ... separate reactions were performed for the quantification of SARS-CoV-2 N and E gene transcripts as well as cellular RNaseP for normalization using the Luna Universal Probe One-Step RT-qPCR Kit (NEB) on a Bio-Rad CFX384 Touch system ...
-
bioRxiv - Genomics 2021Quote: All samples that met the previous criteria were submitted to cDNA synthesis protocol using LunaScript™ RT SuperMix Kit (NEB) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Strand-specific CHIKV RNA primers were chosen from previous work [54] to amplify nucleotides 1-1560 of the CHIKV genome and used in reverse transcription reactions with the LunaScript8482 RT SuperMix Kit (NEB), followed by qPCR using the 2x qPCRBIO SyGreen Blue Mix (PCRBIOSYSTEMS) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Total RNA (1-2 μg) was reverse-transcribed using LunaScript™ RT SuperMix Kit (New England Biolabs, Catalog No; E3010S). Quantitative real-time RT-PCR (qRT-PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... RT-qPCR was performed from 1µL of template RNA in a final volume of 5 μL per reaction in 384-well plates using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a QuantStudio 6 Flex thermocycler (Applied Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... Presence of SARS-CoV-2 RNA was determined by using CDC primers and probes with LunaScript RT Supermix Kit (NEB) run on BioRad (Hercules ...
-
bioRxiv - Bioengineering 2022Quote: ... 500 ng of total RNA was used to synthesize cDNA using the LunaScript RT SuperMix Kit (New England Biolabs, E3010L). The Luna Universal qPCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... and the extracted RNA was reverse transcribed using LunaScript® RT SuperMix Kit (Cat. NEB #E3010; New England Biolabs, MA). The feline IFNγ mRNA were evaluated using primers (5’AATACCAGCTCCAGTAAACGG 3’ ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse transcription was performed on 500 ng of total RNA using a LunaScript™ RT SuperMix Kit (New England Biolabs) as according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... RT-qPCR for SARS-CoV-2 from cell lysates was performed using the TaqMan assay for the CDC N1 gene primers and probes from Integrated DNA Technologies (catalog no. 10006600; Integrated DNA Technologies) using the Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) as previously described (6) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µL lysate was used as a template for the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) on a Light Cycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2023Quote: ... The reactions were completed in a final volume of 10 µl using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and relative gene expression analysis using the Livak method was per-formed 53 ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting RNA was used to generate cDNA using the LunaScript®RT SuperMix Kit according to the manufacture’s protocol (New England Biolabs).
-
bioRxiv - Biochemistry 2023Quote: ... 5′ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3′) and the Luna Universal Probe one-step RT-qPCR kit (catalog no. E3006; New England Biolabs). A 20-μL RT-qPCR mixture contained 7 μL of sample ...
-
bioRxiv - Bioengineering 2023Quote: RT-qPCR was carried out from the isolated RNA using the Luna Universal One-Step RT-qPCR Kit (New England Biolabs) following the manufacturer instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Up to 1ug of RNA is then converted into cDNA using the NEB LunaScript® RT Supermix Kit (NEB #E3010) followed by qPCR using the NEB Luna Universal qPCR Master Mix (NEB #M3003) ...
-
bioRxiv - Cell Biology 2023Quote: ... Viral RNA quantification was performed by RT-qPCR using the IP4 set of primers and probe and the Luna Universal Probe One-Step RT-qPCR Kit (NEB). Serial dilutions of a titrated viral stock were analyzed simultaneously to express viral loads as eqPFU per gram of tissue.
-
bioRxiv - Microbiology 2023Quote: ... 10 μM SARS-CoV-2 E-gene Forward (5’- ACAGGTACCTTAATAGTTAATAGCGT-3’) and Reverse (5’-ATATTGCAGCAGTACGCACACA-3’) primers were used with Luna Universal One-step RT-qPCR kit (New England Biolabs) and added to 1 μl supernatant (5μl total ...
-
bioRxiv - Developmental Biology 2024Quote: ... Complementary DNA (cDNA) was prepared from total RNA (5 μg) by reverse transcription using LunaScript® RT SuperMix Kit (NEB). qPCR reactions were performed using Power SYBR Green Master Mix (Thermo ...
-
bioRxiv - Microbiology 2024Quote: Quantification of SARS-CoV-2 E gene subgenomic mRNA (sgmRNA) was conducted using Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs) on a Step One Plus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Systems Biology 2023Quote: ... with 10 µL RT mix (5 µL 5x Maxima RT Buffer, 1.25 µL 10 mM/each dNTP [New England Biolabs #N0447S] ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pre- microRNA sequence of mir-51 was amplified from genomic DNA using PCR and primers 5’-cggcatcgacgacgacgacggtccgaaaagtccgtctacc-3’ and 3’- cagttggaattctacgaatgaactgtattgctgctgggc-5’ and the vector containing the sequence of rgef-1p and unc-54 3’UTR amplified from plasmid rgef-1p::aak-2::unc-54 3’UTR using PCR and primers 5’-cattcgtagaattccaactgagc-3’ and 3’-cgtcgtcgtcgtcgatgc-5’ were used to generate rgef-1p::mir-51::unc-54 3’UTR by using Gibson assembly (NEB E2611).
-
bioRxiv - Immunology 2021Quote: ... The released DNA was cleaned up using Monarch DNA PCR Clean Kit (NEB) and eluted in TE buffer ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon was purified using the Monarch PCR and DNA Cleanup Kit (NEB), and 1 ug used as template for transcription of digoxigenin labelled riboprobes using the DIG RNA Labelling mix (Sigma).
-
bioRxiv - Molecular Biology 2021Quote: ... The next day samples were purified using PCR cleanup kit columns (Monarch, NEB) and eluted using 50 μl kit elution buffer.
-
bioRxiv - Genomics 2022Quote: ... DNA was purified using a Monarch PCR & DNA Clean up kit (NEB, T1030) and eluted in 12 μL of water.