Labshake search
Citations for New England Biolabs :
401 - 450 of 6951 citations for rno mir 155 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μL i7 unique index primer (10 μM) and 25 μL NEBNext High-Fidelity 2X PCR Master Mix (NEB) were added to 21 μl of purified CUT&TAG DNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using unique dual index primer pairs (NEBNext Multiplex Oligos for Illumina from New England BioLabs, # E6440S) according the following parameters ...
-
bioRxiv - Microbiology 2024Quote: ... PCR was performed with medium range primers 24 using Q5 High-Fidelity DNA polymerase (New England Biolabs, Ipswich, MA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... The adaptor-ligated DNA fragments were enriched by PCR using the Illumina Barcode primers and Phusion DNA polymerase (NEB). PCR products were size-selected using 3% NuSieve agarose gels (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... we used NEBNext® Multiplex Small RNA Library Prep Set for Illumina®(Set 1) (catalog#E7300S,NEB) (as described13) ...
-
bioRxiv - Molecular Biology 2023Quote: NCBP1-NCBP2 at 1.2 μM was incubated with mALYREF2 (residues 1-155) at 3.6 μM in the presence of the 5’ cap analog m7GpppG (NEB) at 500 μM at 4 °C for 0.5 hr ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was subjected to OneStep qRT-PCR analysis using Luna Universal One-Step RT-qPCR Kit (New England Biolabs) or Luna Universal Probe One-Step RT-qPCR Kit (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... The lysed cells were directly subjected to qRT-PCR using Luna Universal One-Step RT-qPCR Kit (NEB, #E3005L). The primer sets used in qRT-PCR to detect CI-MPR and CD-MPR mRNA are 5’-CATTCAGTGGGTGACTCTGTT-3’/5’-TGCTCTGGACTCTGTGATTTG-3’ and 5’-GCTCTAGTGAAGAGGCTGAAAC-3’/ 5’-GCACACCCTGAAGATGTAGATG-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA expression was determined using SYBR green Luna Universal One-step RT-PCR kit (New England Biolabs, Cat #E3005L) with a BioRad CFX96 thermocycler ...
-
bioRxiv - Cell Biology 2023Quote: ... Reverse transcription of RNA and quantitative PCR was performed using the Luna Universal One-step RT-qPCR Kit (NEB) using 1 µg of RNA per reaction ...
-
bioRxiv - Developmental Biology 2024Quote: ... and both reverse transcription and PCR were performed using the Luna One-Step Universal RT-qPCR kit (NEB, E3005S) and carried out on the Mic qPCR Machine (BioMolecular Systems ...
-
bioRxiv - Microbiology 2023Quote: ... Primers were designed with the NEB primer design tool (New England Biolabs).
-
bioRxiv - Genomics 2021Quote: Duplicate PCR reactions were set up for each sample with Q5 Hot Start High-Fidelity 2x Master Mix (New England Biolabs, Ipswich, MA, USA) in a 15 μL reaction volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... random primer (NEB #S1330S) (3uM) ...
-
bioRxiv - Molecular Biology 2022Quote: ... appropriate index primer (NEB Single Index ...
-
bioRxiv - Genetics 2024Quote: ... and indexed primers (NEB) and purified with 1.8X Ampure XP beads ...
-
bioRxiv - Biochemistry 2023Quote: ... RL-Con and RL-3X bulge-miR-122 were digested with DraI (New England Biolabs) prior to following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cDNA was then diluted 1:10 with nuclease free water prior to adding 1 µL to a PCR reaction containing 500 uM forward and reverse primer and 1X Q5 Master Mix (NEB). Reactions were cycled 35 times with annealing temperatures calculated by NEB Tm calculator prior to loading on 2% agarose gels ...
-
bioRxiv - Neuroscience 2021Quote: ... and PCR amplified for 13 cycles with Illumina Nextera adapter primers using the NEBNext High Fidelity 2X Master Mix (NEB) with the following PCR program ...
-
bioRxiv - Molecular Biology 2021Quote: ... CMTr1 was amplified from this cDNA with primers pUAST CG6379HA F2 (CGAACCTTCGGACGATGAGAACTCGGAGCCCACGCCCAAGAAG) and pUAST CG6379 F3 (GCAGAATTCGAGATCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGA CGAACCTTCGGACGATGAGAACTCG) with return primer R5 Spe in a nested PCR with Q5 polymerase (NEB) and cloned with EcoRI and SpeI into a modified pUAST vector containing an attB site for phiC31 mediated integration ...
-
bioRxiv - Molecular Biology 2020Quote: Nested PCR was performed with appropriate primers (Supplementary Table S3) using OneTaq Hot Start DNA Polymerase (New England Biolabs, M0481) and OneTaq Standard Reaction Buffer (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... were used in combination with mutation primers (Table 1) to generate overlapped PCR fragments (Phusion High-Fidelity DNA Polymerase, NEB), with disrupted RNA structure at each selected PAR-CL sites ...
-
bioRxiv - Cell Biology 2019Quote: ... the eGFP-FLAG-HA-MLKS2 sequence was PCR amplified with att flanking primers (Table S2) using high fidelity Q5 polymerase (NEB) and cloned into pDONR221 vector by BP cloning (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... All restriction enzymes were obtained from New England Biolabs and all PCR was performed with primers from Integrated DNA Technologies and Q5 polymerase (New England Biolabs). All cloning steps were performed in π-carrying hosts (either DH5αpir (41 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Unique forward primers flanked with a SpeI restriction site and encoding the new target sequence and a common reverse primer flanked with ApaI was used to PCR amplify (Phusion, New England Biolabs) new DNA inserts ...
-
bioRxiv - Microbiology 2019Quote: ... a 328 bp internal fragment of phbC was PCR amplified from the K56-2 genome using primers 1196 and 1197 and Q5 polymerase (NEB). The plasmid ...
-
bioRxiv - Microbiology 2019Quote: ... a 322 bp internal fragment of fliF was PCR amplified from the K56-2 genome using primers 1156 and 1157 and Q5 polymerase (NEB). The fragment and pGPΩ-Tp were double digested with KpnI and EcoRI (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... treated with a USER enzyme and then amplified via PCR using universal primers Next Multiplex Oligos for Illumina (New England Biolabs) and Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Biochemistry 2020Quote: ... the nonstop GFP1-10 sequence was produced by PCR using primers #1 and 2 and Q5 High-Fidelity DNA Polymerase (NEB) with pETGFP 1-10 vector as a template (Cabantous et al. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Riboprobe templates were synthesized from cDNA via standard PCR using opsin specific primers (Table S1) and Q5 High Fidelity DNA polymerase (New England Biolabs). Primers were designed to bind to the coding sequence of target opsins (SWS2B ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR was carried out with primers targeting UPF1 exons 9 and 12 using Q5® High-Fidelity DNA Polymerase (NEB) (Table S5) ...
-
bioRxiv - Biochemistry 2020Quote: DNA templates for in vitro transcription were amplified by PCR using custom DNA primers (IDT) and Phusion Hot Start polymerase (New England BioLabs). 2.5 mL transcription reactions were assembled using a 1000 μL PCR reaction ...
-
bioRxiv - Biochemistry 2021Quote: ... 1000 base pairs upstream and downstream from the clpP2 gene were amplified by PCR using the A–B and C–D primer pairs from table 3 (Phusion polymerase, GC buffer, New England Biolabs). The PCR products were purified with E.Z.N.A ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were constructed and amplified using 1.25 μ Nextera index primers and NEBNext High-Fidelity 2x PCR Master Mix (New England BioLabs). A quantitative PCR was run to determine the optimal number of cycles ...
-
bioRxiv - Microbiology 2020Quote: Template DNA was amplified by PCR using custom DNA primers (Table S3) and recombinant Phusion Hot Start polymerase (New England Biolabs). In vitro transcription was carried out in a volume of 2.5 mL comprising 1.0 mL of PCR reaction as template ...
-
bioRxiv - Systems Biology 2020Quote: The extracted plasmids were amplified using “lib-seq” primers in the Supplementary Table 6 for 10 cycles using Phusion PCR kit (NEB). Each 50 μL PCR reaction consisted of 6 μL of plasmid library ...
-
bioRxiv - Genomics 2021Quote: ... and used to prepare libraries using the Nextera XT Dual-Indexed primer system (Nextera) and NEBNext High-Fidelity PCR Master Mix (New England Biolabs). Libraries were sequenced by the UCSD Institute for Genomic Medicine on an Illumina HiSeq 4000 using paired end reads of 100bp.
-
bioRxiv - Molecular Biology 2020Quote: PCR was carried out with TIDE or amplicon sequencing primers as shown in the Supplementary Table using High Fidelity 2x PCR Master Mix (New England Biolabs). PCR products were purified using the DNA Clean & Concentrator-100 (Zymo ...
-
bioRxiv - Microbiology 2019Quote: ... RRL→ARL or RRL→AAA mutated complementation plasmids were generated using overlap extension PCR using primers harboring the mutation and cloning the resultant products into pX-V5 using Gibson Assembly (NEB).
-
bioRxiv - Genomics 2020Quote: ... Barcode sequences were first amplified by PCR with RM411 and an i5 primer from NEBNext® Multiplex Oligos (NEB #E7600S) for 12 cycles ...
-
bioRxiv - Microbiology 2022Quote: ... and SLC35A1 were amplified using PCR with specific primers and cloned into the pS lentiviral vector [38] using NEBuilder (New England Biolabs).
-
bioRxiv - Genomics 2022Quote: ... The three primer pairs were pooled in a multiplex PCR reaction using the Q5 High-Fidelity DNA Polymerase (New England Biolabs) in a 25 μL final volume as follows ...
-
bioRxiv - Genetics 2022Quote: ... the TSS/Promoter region was amplified by PCR using Illumina compatible primers (TE127 and TE111) from 5 ng plasmid using Phusion HF polymerase (NEB). Sequencing results were analyzed using custom Python scripts to quantify the frequency of each 7 nt TSS sequence.
-
bioRxiv - Genomics 2021Quote: ... by PCR (see 276 bp 5C2 and primer sequences below) using OneTaq Hot Start 2X Master Mix (New England Biolabs). The DNA was purified using the PCR clean-up kit (Qiagen ...
-
bioRxiv - Cancer Biology 2022Quote: ... Illumina indices and adapters for sample multiplexing were added by PCR amplification with Illumina_indX_F and Illumina_indX_R primers using NEBNext® Ultra™ II Q5® Master Mix (NEB, #M0544). Samples were purified using AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2019Quote: The degenerate barcoded plasmid was used as template for PCR using primers containing gene-specific targeting homology arms (1× NEB Q5 Master Mix #M0494S ...
-
bioRxiv - Synthetic Biology 2019Quote: 2 μL of the Dynabeads were used as template for the final PCR using barcoded P5 and P7 primers and Q5 HiFi 2× Master Mix (NEB) + SYBR Green ...
-
bioRxiv - Microbiology 2020Quote: ... The rRNA-subtracted circular product is subjected to a final round of PCR amplification with Illumina adaptor primers [17] using Phusion polymerase (NEB). All the libraries were then quantified ...
-
bioRxiv - Cell Biology 2019Quote: ... the pGL4.10-P plasmid was mutated by PCR using mutant primers and Q5 site-directed mutagenesis kit (New England Biolabs, E0554) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2019Quote: ... the target region was PCR-amplified using primers Deep-F1/R1 with 25 cycles using Q5 High-Fidelity 2X Master Mix (NEB). Second ...