Labshake search
Citations for New England Biolabs :
301 - 350 of 6948 citations for rno mir 129 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Quantitative (q) RT-PCR was carried out using the Luna Universal qPCR Master Mix (NEB) in the CFX384 Real-Time system (Bio-Rad ...
-
bioRxiv - Plant Biology 2024Quote: ... and first strand cDNA was synthesized with One-Taq RT-PCR kit (New England Biolabs), according to manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 50 ul PCR reactions were set up with approximately 1 ug cDNA and Phusion High-Fidelity DNA Polymerase (NEB) was used ...
-
bioRxiv - Genetics 2021Quote: ... The Golden Gate Assembly reaction was set in 200µl PCR tubes (ThermoScientific AB2000) with 2.5 µl 10X T4 DNA ligase buffer (NEB B0202S), 0.5 µl T4 DNA ligase (NEB M0202L) ...
-
bioRxiv - Bioengineering 2020Quote: ... and regions of interest were PCR amplified with the designed primers and Taq polymerase (NEB, M0273S). Amplified DNA was cleaned up with the Monarch DNA Gel Extraction Kit (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... Residual primers and nucleic acids were removed from PCR reactions with Exonuclease I (New England BioLabs) and FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific ...
-
Fruitless decommissions regulatory elements to implement cell-type-specific neuronal masculinizationbioRxiv - Neuroscience 2020Quote: ... Transposed DNA was amplified with barcoded primers in NEBNext High Fidelity 2X PCR Master Mix (NEB) and purified with Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The final 5kb product was enriched by PCR with specific primers using Q5 2x MasterMix (NEB). Another round of assembly was repeated by mixing three 5kb fragments to generate 15kb fragments.
-
bioRxiv - Biochemistry 2021Quote: The Bam35 genomic DNA was used to amplify the gene 2 flanked by KpnI and BamHI sites by PCR with B35SSB_FW_KpnI and B35sSB_RV_BamHI primers (Table S1) and Vent DNA Polymerase (New England Biolabs). The digested PCR product was cloned into a pET-52b(+ ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Microbiology 2022Quote: Phusion polymerase (Thermo) was used for PCR using primers from Microsynth (Switzerland) and restriction enzymes (NEB) for digestion ...
-
bioRxiv - Microbiology 2022Quote: ... PCRs were performed using specific primers (Table S2C) and Q5 High- Fidelity Polymerase (NEB, Hitchin, UK) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... This made DNA accessible for PCR amplification with barcoded primers for Illumina sequencing (NEB, cat# E7335L). PCR amplifications were carried out for 16 cycles [98 °C 30 s ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... PCR enrichment step was performed with NEBNext Multiplex Oligos for Illumina (Dual Index Primers, NEB #E7600), using 64 different combinations of indexed primers ...
-
bioRxiv - Cell Biology 2023Quote: ... 2.5 µL PCR Anchor Primer,1 µL Deoxynucleotide (dNTP) Solution Mix (New England Biolabs, Inc., N0447L), 10 µL Q5® Reaction Buffer (New England BioLabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Molecular Biology 2024Quote: ... PCR was done using intron-specific outward pointing primers (Table S7) and Phusion DNA polymerase (NEB). Purified PCR products were incubated with Taq to add a 3’ A residue and cloned using a Topo cloning kit (Invitrogen) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and NEBNext Multiplex Oligos for Illumina (NEB Set 1 E7335 and Set 2 E7500S). Additional AMPure clean-ups at the start and the end of library preparation were included ...
-
bioRxiv - Cancer Biology 2022Quote: pcDNA3-TNFR1 expression vector was generated by cloning with the primers indicated below to PCR amplify (using Q5 High-Fidelity PCR kit, New England Biolabs, Euroclone, Milan, Italy) the TNFR1 reference sequence from pBMNZ-neo-Flag-TNFR1 L380A (gift from Martin Kluger ...
-
bioRxiv - Systems Biology 2023Quote: ... PCR with custom Nextera PCR primers was then performed for five cycles using NEBNext Q5 Hot Start HiFi PCR Master Mix (New England Biolabs, Ipswich, MA, USA) 76 ...
-
bioRxiv - Microbiology 2023Quote: ... Amplification was achieved through 16S rRNA gene Polymerase Chain Reaction (PCR) with Illumina (San Diego, USA) adapted primers [50] and NEBNext® High-Fidelity 2X PCR Master Mix (New England Biolabs, Ipswich, USA) at 98°C (2 minutes ...
-
bioRxiv - Microbiology 2023Quote: ... one primer pair (cDNA template, and nuclease-free water. The thermal cycle of the RT-qPCR machine was set up based on NEB #M3003 instruction manual (NEB, UK). Transcription values (Ct ...
-
bioRxiv - Molecular Biology 2020Quote: ... and a ribonucleotide set (NEB) following the manufacturer’s recommendations for 2h at 37°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Pathology 2022Quote: ... qRT-PCR analysis was carried out using the Luna Universal One-Step RT-qPCR kit (NEB) using 100 ng RNA as input according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... One-step qRT-PCR was performed using the Luna Universal One-Step RT-qPCR Kit (NEB) and 5 ng RNA per reaction in technical duplicate with a StepOnePlus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: Conventional RT-PCR was performed using Phusion® High-Fidelity DNA Polymerase kit (New England Biolabs) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... before cDNA was synthesized with the AMV LongAmp® Taq RT-PCR kit (New England Biolabs). A 500bp fragment covering the second and third exons common to all polymorphic MHC class I genes as amplified from each cDNA using NEB Go Taq polymerase and ovine MHC class I generic primers 416 and Cr as described in36 ...
-
bioRxiv - Genomics 2019Quote: ... NEBNext Multiplex Oligos for Illumina (NEB, Set 1; cat. # E7335, NEB, Set 2; cat. # E7500) were used for multiplexing ...
-
bioRxiv - Neuroscience 2021Quote: ... of PCR amplicon was used for NGS library preparation with the NEBNext ChIP-Seq Library Prep Reagent Set for Illumina (NEB) for samples from library #1 and the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... using the random primer method (Random Primer 6, NEB S1230S ...
-
bioRxiv - Genetics 2020Quote: ... and amplified by PCR with barcoded universal primers NEBNext Multiplex Oligos for Illumina (#E7335, New England Biolabs), using Kapa HiFi Polymerase (KAPA Biosystems) ...
-
bioRxiv - Biochemistry 2021Quote: ... A PCR was then performed with VHH IgG specific primers and Deep Vent polymerase (New England Biolabs). Forward primers 6N_CALL001 5′-NNNNNNGTCCTGGCTGCTCTTCTACAAGG-3′ and 6N_CALL001B 5′-NNNNNNGTCCTGGCTGCTCTTTTACAAGG-3′ target the leader sequence ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were amplified with i5/i7 Nextera primer index mix and Q5 PCR Master Mix (NEB #M0492L): 5 min 72°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pool was amplified by PCR with primers oBZ131 (GCTAATACGACTCACTATAGGG) and oTC_pool2_rev (GTCCTTGGTGCCCGAGTG) using Phusion Polymerase (NEB). PCR reactions were supplemented with 3% DMSO and gel purified prior to in vitro transcription ...
-
bioRxiv - Bioengineering 2022Quote: ... and assembled into PCR-linearized (primers 454 and 455) pUC19-Kan by Gibson assembly (New England Biolabs).
-
bioRxiv - Cancer Biology 2023Quote: ... The TERT promoter was then amplified with PCR using corresponding primers with the Q5 DNA polymerase (NEB) (Supplementary Table S1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were used in a polymerase chain reaction (PCR) with 2X Phusion Master Mix (New England Biolabs) and the appropriate parent plasmid ...
-
bioRxiv - Developmental Biology 2023Quote: ... The DNA was PCR amplified for 12 cycles using indexed primers (New England BioLabs, E7335S or E7500S) to barcode samples ...
-
bioRxiv - Developmental Biology 2024Quote: ... 8 PCR cycles for enrichment of adaptor-ligated DNA with unique dual index primer pairs from NEB. The libraries were sequenced on the NovaSeq 6000 system with NovogeneAIT Genomics ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2.5𝜇L of each primer (Where each reaction had non-barcoded primer "Ad1_noMix" and one barcoded primer ’Ad2.1’ - ’Ad2.9’ added) and 25𝜇L NEBNext High-Fidelity 2x PCR Master Mix (NEB) and was run under the following conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCC 7002 gDNA by PCR using the Syn0852-FULL-F6/R4 primers and Phusion DNA polymerase (NEB). The pET21c-GPR-EGFP vector was PCR-linearized with pET-F/R and pre-digested with HindIII-HF and XhoI (NEB) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 μL of PCR product from the inner primer amplification was cleaned using 5μL Exonuclease I (NEB) and 2μL rSAP (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... The reaction was topped up to 200μL with DEPC treated water and a phenol chloroform extract performed (as before except the pellet was resuspended in 17.5μL DEPC treated water. The SR RT primer (NEB small RNA kit for Illumina) was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The templates of dsRNA were initially amplified from the first-strand cDNA and secondary amplified from the initial PCR products by RT-PCR using Q5 High-Fidelity DNA Polymerase (New England Biolabs Japan Inc., Tokyo, Japan). The initial PCR primers are described as Hvig_diap1_F/Hvig_diap1_R ...
-
bioRxiv - Microbiology 2019Quote: ... RT-PCR was performed in a 50 µl reaction mixture with One Taq 2x master mix (NEB), 20 ng of cDNA and 0.2 µM of each primer (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: RNA used for RT-PCR was treated with 8 U of DNase I (RNase-free, NEB, M0303) for 15 min at 37 °C in a 50 μl reaction ...
-
bioRxiv - Microbiology 2023Quote: ... Transcript levels of individual genes were determined by the Luna Universal One-Step RT-PCR kit (NEB) using approximately 100-200 ng of total RNA per sample as input ...
-
bioRxiv - Molecular Biology 2023Quote: ... All qRT-PCR reactions were performed with the Luna Universal One-Step RT-qPCR kit (E3005 NEB) according to manufacturer protocol with a few modifications ...