Labshake search
Citations for New England Biolabs :
101 - 150 of 1669 citations for Urotensin 2 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: 2 μg of nucleosomes were incubated with 2 Kunitz units of Micrococcal nuclease (NEB) in buffer containing 10 mM Tris HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl 1M MgCl2 and 2 μl of 1 U/μl Xrn1 (M0338, NEB) were added after RNase H digest ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 30 min at 37 °C ...
-
bioRxiv - Immunology 2021Quote: ... α2-3,6,8,9 neuraminidase A (NEB), LB Broth (BD Difco™) ...
-
bioRxiv - Microbiology 2020Quote: ... 2) NEB Q5 (NEB M0491), 3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... T4 RNA ligase 2 (NEB) and RiboLock RNase inhibitor (ThermoFisher Scientific ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL DpnI (NEB # R0176L) is then added and the reaction incubated 1h at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 units DNase I (NEB) or both for 1 hour at 37°C and resolved on a denaturing urea polyacrylamide gel (15% ...
-
bioRxiv - Immunology 2020Quote: ... 2 U DNase I (NEB) was added to IVT mixture and further incubated at 37 °C for 30 min ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 units DNase I (NEB), or both for 1 h at 37°C and resolved on a denaturing urea polyacrylamide gel (20% ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 μL DpnI (NEB # R0176L) is then added and the reaction incubated 30 min at 37°C ...
-
bioRxiv - Biochemistry 2019Quote: ... 2 U UDG (NEB, M0280S), and 1X UDG buffer (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... in 1× NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... in 1x NEBuffer 2 (NEB) at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μl Proteinase K (NEB) was added and samples were incubated at 56°C for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... 2 µL factor mix (NEB), 250 nM pre-incubated 50S subunit ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL ATP (NEB, B0202S), 2 μL 10X restriction digest buffer (Thermo Scientific ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and set 2 (NEB #7500S) according to the manufacturer’s protocol with minor modifications as noted below ...
-
bioRxiv - Developmental Biology 2023Quote: ... and Set 2 (E7500S, NEB). Quality of the final library preparation was analysed on the Bioanalyzer using the High Sensitivity DNA reagents kit and cassettes (5067-4626 ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2 mM ATP) (NEB) at 30 °C for 1 h ...
-
bioRxiv - Immunology 2022Quote: ... with 2 mM MgCl2 (NEB), 0.2mM dNTPs (made in house) ...
-
bioRxiv - Genomics 2024Quote: ... 2 μl of BSA (NEB), 15 μl of dNTPs 10 mM ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μl 10 mM dNTPs and 1 μl Bst 2 WarmStart DNA polymerase (NEB M0538S) was added and sample incubated 30 min at 65°C before precipitation with 12.5 μl 10 M NH4OAc ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Developmental Biology 2022Quote: ... fluorescent protein mCherry sequence and self-cleaving P2A peptide sequence (5’HA-H2B-mCherry-P2A-3’HA) in a pUC19 vector backbone using Gibson Assembly (New England Biolabs (NEB), E5510S) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Genetics 2021Quote: ... 2 × 2 µg of gDNA were digested in parallel with 50 units of DpnII (NEB #R0543L) and NlaIII (NEB #R0125L ...
-
bioRxiv - Biochemistry 2020Quote: ... 2 µl T4 DNA ligase buffer and 2 µl 10 mg/ml BSA (New England Biolabs). These reactions were placed in a thermocycler with following program ...
-
bioRxiv - Microbiology 2022Quote: ... 2 µL NEBNext Bacterial rRNA depletion solution and 2 µL Probe Hybridization Buffer (NEB, CN E7850) were mixed with cells on ice ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 mM vanadyl ribonucleoside complex (NEB), 0.02% RNase-free BSA (ThermoFisher) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 mM Vanadate (Sodium Orthovanadate, NEB, pre-incubated for ten minutes at 95 °C to dissociate Vanadate oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 μL 10 mM dNTPs (NEB), 9 μL Nuclease-free water ...
-
bioRxiv - Neuroscience 2020Quote: ... 2× Protoscript Buffer (New England Biolabs), 12 mM MgCl2 (ThermoFisher) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 μl Q5 polymerase (NEB, M0491), 10 μl Q5 reaction buffer and 31 μl H2O with the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 µl 5x Phusion buffer (NEB), 0.2 µl 10 mM dNTPs (NEB) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 mM Ribonucleoside Vanadyl Complex (NEB), Roche cOmplete™ ...
-
bioRxiv - Genomics 2020Quote: ... + 2 uL DpnI (New England Biolabs) + up to 100 uL water.
-
bioRxiv - Genetics 2020Quote: ... NdeI (NEB, Figure 2 and 5) and SacII (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl BSA (New England Biolabs), 10 μl dNTPs (Thermofisher) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl SrfI (New England Biolabs), and MilliQ (until a volume of 50 μl) ...
-
bioRxiv - Systems Biology 2020Quote: ... 2 μL T4 ligase buffer (NEB), 1 μL BsmBI restriction enzyme (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2020Quote: ... 2 mM Vanadyl ribonucleoside complex (NEB), 0.02% RNAse-free BSA (ThermoFisher) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB) or 10 units of HpaII (NEB ...
-
bioRxiv - Neuroscience 2019Quote: ... and 2 units of HaeIII (NEB), to assess the methylation status of two CpG sites in the promoter region ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 units Phusion Polymerase (NEB)) ...
-
bioRxiv - Genomics 2022Quote: ... and 2 μL NlaIII (NEB, R0125L) in 100 μL reaction mixture at 37 °C for 30 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 2 units RNA-free DNAse (NEB) was added and reactions left at 37°C for 30 minutes ...