Labshake search
Citations for New England Biolabs :
1 - 50 of 142 citations for Tyr PDGF A Chain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: SpyCas9 tyr and tbxta sgRNAs were synthesized using EnGen sgRNA Synthesis Kit (NEB). SauCas9 ...
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
bioRxiv - Immunology 2021Quote: VH and VL sequences of candidate sequences were cloned into a pcDNA.3 based vector with dual CMV promotor harboring IgG1 heavy chain and light chain backbone using NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs).
-
bioRxiv - Immunology 2023Quote: ... and the V regions were inserted into cut backbone vectors (heavy chain: FJ475055; kappa chain: FJ75056) via Gibson reaction (New England Biolabs). Successful clones were prepared ...
-
bioRxiv - Biochemistry 2022Quote: Reporter protein-expressing plasmids for measuring Tyr decoding ability were generated by integrating frameshift sequences testing Tyr codon decoding and linearized from pMMB207 encoding mCherry and bright GFP using NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Microbiology 2022Quote: ... the template chain was digested using DpnI restriction endonuclease (NEB, USA). Afterward ...
-
bioRxiv - Molecular Biology 2020Quote: ... Polymerase chain reactions (PCRs) were performed using Phusion DNA polymerase (NEB) according to manufacturer’s protocols ...
-
bioRxiv - Microbiology 2022Quote: Polymerase chain reaction (PCR) was performed with Phusion DNA polymerase (NEB) in a total volume of 50 µl in GC buffer containing 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... was amplified from mouse cDNA by polymerase chain reaction (NEB, M0492L) using primers below:
-
bioRxiv - Synthetic Biology 2020Quote: ... Polymerase chain reactions were performed with Q5 DNA Polymerase (NEB, Ipswich, MA). pSMART-HC-Kan (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... A polymerase chain reaction (PCR) amplification using OneTaq Master Mix (NEB, M0482) was performed on C ...
-
bioRxiv - Microbiology 2022Quote: Eight units of enteropeptidase light chain (New England Biolabs, 16 units per µL) and 25 µg of Esp743 (50 µg/µL ...
-
bioRxiv - Microbiology 2020Quote: Polymerase chain reaction (PCR) was performed using Q5 DNA polymerase (New England Biolabs). For cloning ...
-
bioRxiv - Cell Biology 2022Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Cell Biology 2024Quote: ... or else generated by polymerase chain reaction and HiFi assembly (New England Biolabs) according to the manufacturer’s instructions:
-
bioRxiv - Immunology 2021Quote: ... gBlocks were amplified by polymerase chain reaction (PCR) using Q5 polymerase (New England BioLabs) following the manufacturer’s protocol ...
-
Imaging of Morphological and Biochemical Hallmarks of Apoptosis with Optimized Optogenetic ActuatorsbioRxiv - Biochemistry 2019Quote: The Cry2(1-531) gene was amplified by polymerase chain reaction (NEB Q5 polymerase) from the full length Cryptochrome-2 gene using a forward primer encoding an XhoI-restriction site with the sequence ...
-
bioRxiv - Genetics 2019Quote: ... the desired concentration for the PCR (Polymerase Chain Reaction) protocol (New England Biolabs Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... were amplified by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA polymerase (NEB) and digested using NotI ...
-
bioRxiv - Microbiology 2023Quote: ... used for Polymerase Chain Reaction (PCR) and Golden gate cloning kit (New England Biolabs) were carried out according to the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: Polymerase Chain Reaction (PCR) was performed using Q5 High Fidelity 2X Master Mix (NEB) with primers synthesized by Integrated DNA Technologies (IDT ...
-
bioRxiv - Molecular Biology 2023Quote: ... Polymerase chain reaction (PCR) was performed with Q5-HF polymerase (New England Biolabs, USA) or with CloneAmp Hifi polymerase (Takara Bio ...
-
bioRxiv - Microbiology 2021Quote: ... Polymerase chain reactions (PCR) were performed using Phusion High-Fidelity DNA Polymerase (New England Biolabs), and gel-purified products (hph and the gene of unknown function with 73% homology to an AAC(2’)-IIa resistance gene ...
-
bioRxiv - Microbiology 2019Quote: ... Polymerase Chain Reaction (PCR) was conducted following standard conditions outlined by New England Biolabs (NEB) (Ipswich ...
-
bioRxiv - Biophysics 2021Quote: ... 5 μL proteoliposomes were mixed with 8 units of enterokinase light chain (New England Biolabs) and diluted to 20 μL ...
-
bioRxiv - Immunology 2020Quote: Heavy and light chain vectors were verified by sequencing and transformed into DH5alpha cells (NEB). The transformed cells were grown and the plasmid was purified by midiprep (Macherey-Nagel) ...
-
bioRxiv - Biophysics 2020Quote: ... tinctorius Nav1.4 genes by polymerase chain reaction (PCR) using Phusion® HF (New England Biolabs). PCR products were gel extracted and sequenced to determine the full-length P ...
-
bioRxiv - Synthetic Biology 2021Quote: ... all linear polymerase chain reaction (PCR) products (Q5 High-Fidelity DNA Polymerase, New England Biolabs) were extracted by gel extraction and then ligated using NovoRec plus One step PCR Cloning Kit (Novoprotein) ...
-
bioRxiv - Zoology 2023Quote: ... Polymerase chain reaction (PCR) was performed using LongAmp Taq 2X Master Mix (New England Biolabs) and previously described primers GLU (5’ GACTTGAAGAACCACCGTTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: Human ARHGAP18 constructs were created using Polymerase Chain Reaction (PCR) using New England Biolabs (NEB) Phusion High-Fidelity PCR Kit (catalog no ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were carried out with Q5 Hot Start High-Fidelity DNA polymerase (NEB). Colony PCRs were performed with Taq polymerase (NEB) ...
-
bioRxiv - Systems Biology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
Unraveling the functions of uncharacterized transcription factors in Escherichia coli using ChIP-exobioRxiv - Systems Biology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2020Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again with a GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... The polymerase chain reaction (PCR) was performed with “Taq DNA Polymerase with Standard Taq Buffer” (NEB) according to company’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... 18ng heavy or light chain fragment and 10ul of Gibson assembly master mix (New England Biolabs). 5-alpha competent E ...
-
bioRxiv - Systems Biology 2019Quote: ... was enriched by polymerase chain reaction (PCR) using Phusion High-Fidelity DNA Polymerase (New England Biolabs). The amplified DNA samples were purified again by GeneRead Size Selection Kit (Qiagen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Polymerase chain reactions (PCRs) were conducted using Q5 High-Fidelity 2x Master Mix (New England Biolabs) in the presence of 0.5 µM of forward and reverse primers in a volume of 25 µL ...
-
bioRxiv - Biochemistry 2020Quote: ... The polymerase chain reaction (PCR) included 1-unit Phusion High-Fidelity DNA Polymerase (New England Biolabs), 1x Phusion buffer ...
-
bioRxiv - Microbiology 2022Quote: ... The DST was removed by incubating the protein with 64 units of Enterokinase light chain (BioLabs) in 10 mM Tris-HCl ...
-
bioRxiv - Biochemistry 2022Quote: ... pDONR/Zeo plasmid was linearized via Polymerase Chain Reaction (PCR) with the Q5 DNA polymerase (NEB) and a pair of primers for each Cac1 mutant that anneal to the sequences flanking the section to be modified (Supplementary Table 2) ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... Template DNAs were prepared by polymerase chain reaction (PCR) using Q5 High-Fidelity DNA Polymerase (NEB) with the following primers ...
-
bioRxiv - Cell Biology 2023Quote: ... and fragments were generated by polymerase chain reaction (PCR) using Phusion High-Fidelity Polymerase (M0530L, NEB) using 35 cycles and 60°C annealing temperature ...
-
bioRxiv - Bioengineering 2024Quote: All polymerase chain reactions were performed using Q5 High-Fidelity 2X Master Mix (New England Biolabs) and all primers were synthesized by IDT (Integrated DNA Technologies) ...
-
bioRxiv - Bioengineering 2021Quote: ... GFP and taCA were cloned by polymerase chain reaction (PCR) using pMAL-c5X (New England Biolabs, USA), pGEX-4T-1 (GE Healthcare ...
-
bioRxiv - Immunology 2019Quote: ... Polymerase chain reactions (PCR) for cloning steps were performed with Phusion High Fidelity polymerase (New England Biolabs). KHNYN-2 (NM_001290256 ...
-
bioRxiv - Microbiology 2021Quote: ... All fragments were amplified by polymerase chain reaction (PCR) using Q5 DNA polymerase (New England Biolabs, USA). Fragments to be ligated contained regions of 20-30 bp of homology ...
-
bioRxiv - Molecular Biology 2023Quote: ... Primers were used in a polymerase chain reaction (PCR) with 2X Phusion Master Mix (New England Biolabs) and the appropriate parent plasmid ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cDNA was amplified in two stages of Polymerase Chain Reaction (PCR) using Q5 DNA polymerase (NEB). For the first PCR reaction ...