Labshake search
Citations for New England Biolabs :
651 - 700 of 6017 citations for Type 1 Angiotensin II Receptor AGTR1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... DNA libraries were prepared using NEBNext Ultra II DNA Library Prep Kit (NEB #E7645S), and sequenced by NovaSeq 6000 System.
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using ProtoScript II reverse transcriptase (New England Biolabs, USA) with oligo dT primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by the NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB, E7770). The quality and concentration of libraries were assessed with Bioanalyzer (Agilent ...
-
bioRxiv - Genomics 2022Quote: ... the NEBNext Ultra II DNA library prep kit (New England Biolabs, Ipswich, MA, USA) was used according to protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... First-strand cDNA was synthesized using a ProtoScript II cDNA first strand kit (NEB) with 1 μg of total RNA ...
-
bioRxiv - Microbiology 2023Quote: cDNA libraries were prepared using a NEBNext Ultra II RNA Library Prep Kit (NEB). RNA and cDNA quality and quantity were evaluated by performing a Qubit assay with the TapeStation 4200 system (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 µg of lysates were deglycosylated using Protein Deglycosylation Mix II (NEB Cat# P6044S). In short ...
-
bioRxiv - Bioengineering 2023Quote: ... and sequencing libraries were prepared using a NEBNext Ultra II kit (NEB, catalog E7645L). Samples were sequenced with 50-bp paired-end reads on an Illumina NextSeq at a depth of 30 million reads per sample ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB, Cat# E7765) was used to generate sequencing libraires from 1 μg of total RNA ...
-
bioRxiv - Immunology 2023Quote: ... followed by the NEBNext Ultra II Directional RNA Library Prep Kit (CAS: E7760S, NEB). Completed libraries were then sequenced to an average depth of approximately 20M reads per sample on a partial lane of the NovaSeq6000 S4 XP flow cell using 2×150 paired-end reads with 10-base dual indexes (CAS ...
-
bioRxiv - Synthetic Biology 2023Quote: ... NEBNext ULTRA II FS DNA Library Prep (New England Biolabs, Ipswich, MA, USA, #E6177) was used ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were prepared with the NEBNext Ultra II Library Prep Kit for Illumina (NEB) and paired-end sequencing was performed using an Illumina Novaseq instrument.
-
bioRxiv - Neuroscience 2023Quote: ... University of Oxford using NEBNext Ultra II Directional RNA Library Prep Kit (NEB, #E7760) and sequenced on NovaSeq6000_150PE (150 bp paired-end directional reads ...
-
bioRxiv - Genetics 2023Quote: Sequencing library was constructed by NEBNext ultra II DNA library prep kit (NEB E7103L). 50 million paired-end 50bp reads were obtained for each ChIP and input sample using a NextSeq 2000 instrument ...
-
bioRxiv - Genomics 2023Quote: ... followed by NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) and NEBNext® Multiplex Oligos for Illumina® Index Primers Set 1 (NEB# E6440) ...
-
bioRxiv - Genomics 2023Quote: ... and NEBNext Ultra II End repair/dA-tailing Module (New England Biolabs, Ipswich, MA) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library was prepared using Ultra II Directional RNA Library Prep Kit (NEB, Cat #E7765) for all samples ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using the NEBNext Ultra II DNA Library Kit for Illumina (NEB) and sequenced with an Illumina Novaseq 6000 system to produce 50 bp paired-end reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... we used the NEBNext® UltraTM FS II Library Prep kit (New England Biolabs) with default parameters ...
-
bioRxiv - Molecular Biology 2023Quote: Libraries for ChIP-seq were prepared with NEBNext Ultra II DNA Library kit (NEB) according to the manufacturer’s instructions with the following modifications ...
-
bioRxiv - Molecular Biology 2023Quote: ... for mRNA enrichment and Ultra II directional RNA Library Prep Kit (NEB, Cat# E7760) following the manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2023Quote: ... and processed with the NEBNext Ultra II DNA library preparation kit (New England Biolabs). Sequencing was performed on MiSeq sequencers (Illumia) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we generated libraries using the NEBNext Ultra II protocol for Illumina (NEB, E7645S-E7103S), with minor adjustments ...
-
bioRxiv - Genomics 2024Quote: ... Reverse transcription was performed with dT priming using the ProtoScript II RT (NEB M0368L) as described by the manufacturer ...
-
bioRxiv - Microbiology 2024Quote: ... Metagenomic libraries were prepared using the NEB Ultra II kit (NEB; Cat. No. E7645L) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by library preparation using NEBNext Ultra II RNA Library Preparation Kit (NEB, E7770S). Libraries were paired-end sequenced with read lengths of 150 bp on Illumina HiSeq X Ten or Nova-seq instruments ...
-
bioRxiv - Plant Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II RNA Library Prep Kit for Illumina (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB). Libraries were pooled and sequenced with paired end sequencing on a Novoseq 6000 (Novogene).
-
bioRxiv - Neuroscience 2024Quote: ... and cDNA was generated using the ProtoScript II Reverse Transcription Kit (New England BioLabs). qPCR was performed on a LightCycler 480 real time PCR system (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were prepared using NEBNext Ultra II DNA Library prep kit (New England Biolabs) following manufacturer’s instructions for H3K9ac CUT&RUN DNA ...
-
bioRxiv - Molecular Biology 2024Quote: The purified RNA was reverse transcribed using ProtoScript® II Reverse Transcriptase (NEB, M0368L). The 20 μL reaction volume containing 4 µL 5 × ProtoScript II buffer ...
-
bioRxiv - Molecular Biology 2024Quote: DNA libraries were prepared according to the manufacturer’s protocol (NEBNext® Ultra II, NEB) with some minor adjustments for CUT&RUN samples ...
-
bioRxiv - Microbiology 2024Quote: ... First-strand cDNA was synthesized using ProtoScript II first strand cDNA synthesis kit (NEB), and quantitative real-time PCR was performed on QuantStudio 3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2024Quote: ... and then immediately followed by Library prep using NEBNext Ultra II kit (NEB, E7770). Libraries were pooled and sequenced using a H75 kit from Illumina in a NextSeq500 sequencer following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2024Quote: ... The rRNA-depleted samples were reverse-transcribed with ProtoScript II (M0368L, New England Biolabs), circularized with CircLigase II (CL9025K ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Libraries were prepared using NEBNext ultra II DNA library kit for Illumina (NEB Biolabs) according to the manufacturer instructions ...
-
bioRxiv - Biophysics 2022Quote: ... single point mutations were introduced to the respective wild-type plasmids by site-directed mutagenesis using the Q5 site-directed mutagenesis Kit (NEB). The used primers are listed in table 1.
-
bioRxiv - Microbiology 2019Quote: ... were amplified from genomic Synechocystis 6803 wild type DNA using specific primers (Table S1) and Phusion Polymerase (New England Biolabs). After restriction digest with BamHI and NotI ...
-
Calibrated feedback illumination for precise conventional fluorescence and PALM imaging applicationsbioRxiv - Biophysics 2019Quote: ... Wild-type ADE2 was amplified from genomic DNA, RB201 (W303 MATa, trp1, leu2, ura3, his3, can1R, ADE2) with Phusion PCR (NEB) using the forward primer (ATGGATTCTAGAACAGTTGGTATATTGGGAGGGGGACAA ...
-
bioRxiv - Genomics 2020Quote: We used the prepared DNA of each clone and the wild type gene for amplification by PCR with Q5 polymerase (NEB) using primers which included the minION barcodes adapters ...
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Biochemistry 2020Quote: ... Human wild-type TDP-43 was amplified in two separate PCR reactions excluding the NLS and reassembled using Gibson cloning (NEB) into a Doxycycline-inducible expression vector containing an N-terminal mClover3 tag ...
-
bioRxiv - Neuroscience 2019Quote: ... The R1320P mutation was created in a wild-type cDNA using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Wild-type and R1320P mutant dNf1 were then subcloned into the pUAST-attB vector with an in-frame C-terminal fusion with eGFP cDNA ...
-
bioRxiv - Cell Biology 2020Quote: ... CASP1 and CASP4 CDS were amplified from the obtained library and cloned into the pMSCV-puro vectors The caspase-4 catalytically dead C258A pMSCV-puro vector was generated from the wild-type pMSCV-puro-CASP4 through site-directed mutagenesis by PCR using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). The CASP4 and GSDMD-targeting lentiviral vectors (pGIPZ ...
-
bioRxiv - Cell Biology 2020Quote: ... The open reading frame for a KIF18A wild-type siRNA resistant construct51 and pEM791 vector49 were amplified with primers designed for Gibson Assembly (New England BioLabs). After confirming the correct sequence of the Gibson assembled plasmid ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Biophysics 2021Quote: ... The 5’-terminus was capped with a type I 7-methylguanosine cap (m7G) using the Vaccinia Capping System (NEB, M2080S) and 2’-O-methyltransferase (NEB ...
-
bioRxiv - Biochemistry 2019Quote: ... Most point mutants and wild-type variants were generated from this vector following the Q5 Site-Directed Mutagenesis Kit protocol (E0554, New England Biolabs) and primers 1-8 (Sup ...
-
bioRxiv - Bioengineering 2020Quote: In-vitro digestion reactions were carried out with three different types of the Cas12a family (LbCas12a, AsCas12a, and FnCas12a were purchased from New England Biolabs Inc. ...