Labshake search
Citations for New England Biolabs :
501 - 550 of 795 citations for Trans 4 Hydroxy L Proline Rabbit Polyclonal Conjugated since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... HeLa-CENP-A-SNAP cells were grown in 6 well plates and pulse labeled with tetra-methyl-rhodamine-conjugated SNAP substrate (TMR-Star; New England Biolabs) at 4µM final concentration ...
-
bioRxiv - Plant Biology 2019Quote: ... Lysates pre-cleared for 15 minutes with 50µl goat anti-rabbit magnetic beads (NEB). Pre-cleared lysates were then incubated with either goat anti-rabbit magnetic beads only (mock IP ...
-
bioRxiv - Microbiology 2019Quote: ... followed by Alexa Fluor 488 goat anti-rabbit secondary antibody (New England Biolabs, UK) for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was initiated by adding 4 μl of 5× ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Microbiology 2019Quote: ... and 4 μL was ligated at 16°C overnight with the T4 DNA ligase (NEB M0202S). After transformation into chemically-competent Top10 E ...
-
bioRxiv - Biophysics 2020Quote: ... the 5’ end of the 4 kb transcript was biotin-labeled using Vaccinia Capping System (NEB) and 3-biotin-GTP (NEB ...
-
bioRxiv - Biophysics 2021Quote: ... Primers were designed for the replacement of each of the 4 loops using Q5 polymerase (NEB) PCR reaction and a KLD enzyme mix (NEB) ...
-
bioRxiv - Microbiology 2021Quote: ... after ligation overnight at 4°C with the T4 DNA ligase (New England Biolabs, Evry, France).The sequences of the cloned fragments in the resulting plasmids pYES2::MlpCSP1 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mM DTT) supplemented with 200 μM cold SAM (S- adenosyl methionine) (NEB; for immunoblotting) or 1 µCi 3H-labelled SAM (PerkinElmer ...
-
bioRxiv - Genetics 2022Quote: ... Donor 4) were combined in a single ligation reaction using T4 DNA Ligase (New England Biolabs) according to the manufacturer’s instructions and incubated overnight at 16°C ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were collected and incubated with 4 μM SNAP-Cell TMR-Star (New England Biolabs S9105) or SNAP-SiR647 (New England Biolabs S9102 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the extension enzyme was replaced with 4 units of Bst 2.0 Warmstart DNA Polymerase (NEB, Cat.No.M0538). Correspondingly ...
-
bioRxiv - Molecular Biology 2019Quote: ... Reverse transcription was initiated by adding 4 μl of 5X ProtoScript II Buffer (New England Biolabs), 2 μl of 0.1 M DTT ...
-
bioRxiv - Molecular Biology 2020Quote: ... an end-repair mastermix was made by combining 4 μl T4 DNA Ligase Reaction Buffer (NEB), 0.5 μl dNTP (10mM ...
-
bioRxiv - Biochemistry 2019Quote: ... 4°C) and the supernatant was added to 24 mL of amylose resin (NEB, Ipswich MA) pre-equilibrated with buffer C and nutated for 2 hr at 4°C ...
-
bioRxiv - Plant Biology 2023Quote: ... 10 ul of diluted DNA were used for McrBC digestion (NEB, 4 h at 37 °C) or mock digestion (the same volume of H2O instead of McrBC enzyme was added with all other components the same in the reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3-4 μg of sperm gDNA was dephosphorylated with 10 μl of rSAP (NEB, no. M0371S) and 16 μl of 10× rCutSmart buffer (NEB ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 pmol of double-stranded DNA was labeled with 1 unit of Klenow fragment polymerase (NEB) and 8 pmol Cy5-dCTP (Cytiva ...
-
bioRxiv - Genomics 2023Quote: ... 20 µg of total RNA was then treated with 4 units of DNAse I (NEB, #M0303S) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4 targeted CDRs were amplified by error-prone PCR using Taq polymerase (New England Biolabs), 1× Taq buffer (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 % cDNA product was used to perform semiquantitative PCR using 50 % Taq MM (New England Biolabs) and 0.5 µM of the forward (GAACCAGGAGTTAAGAACACG ...
-
bioRxiv - Genetics 2023Quote: ... and NEBNext Multiplex Oligos for Illumina (96 Unique Dual Index Primer Pairs Set 4) (NEB, E6446S) as index primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... Oligos were 5’-end radiolabeled at a final concentration of 4 μM with T4 PNK (NEB) and γ-32P-ATP after incubation for one hour at 37°C followed by enzyme inactivation at 72°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... for which the completed ligation reaction was treated with 4 µL RecJf (New England Biolabs, M0264L) and 3 µL 5ʹ Deadenylase (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... Charles Gersbach) was PCR amplified (primers in Extended Data Table 4) and cloned into KpnI(NEB)-digested pLV-hUbC-dSpCas9-2xVP64-T2A-BSD via blunt-end ligation cloning (NEB) ...
-
bioRxiv - Genetics 2024Quote: ... m7G(5’)ppp(5’)G RNA Cap Structure Analog (New England Biolabs, 4:1 to GTP) was supplemented to the in vitro transcription reaction ...
-
bioRxiv - Genomics 2024Quote: ... 4 μg of the barcoded plasmid library was linearized by digestion with NruI-HF (NEB #R3192) at 37°C for 16 hours ...
-
bioRxiv - Developmental Biology 2024Quote: ... The PCR products (∼300 ng) were incubated with 2 μl 10X NEBuffer 4 (New England Biolabs), 1 μl BtsCI restriction enzyme ...
-
bioRxiv - Genomics 2020Quote: ... Multiple adapters were used for pooling libraries (KAPA Single-Indexed Adapter Kit KK8700 and NEBNext® Multiplex Oligos for Illumina NEB #E7535S/L). The DNA samples were sequenced using the Illumina NextSeq 500 platform and 150-nucleotide single-end reads were generated ...
-
bioRxiv - Genomics 2020Quote: ... 50-100 fmol of PCR products were diluted in 9 µl then mixed with 1 µl of Rapid 1D Adapter and 1 µl of Ligase T4 Blunt (New England Biolabs, Ipswich, MA, USA). Pre-sequencing mix was incubated 10 min at 25°C and left on ice until ready to load ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 µ l of cfDNA was incubated at 37°C for 1 hour with the following reaction mixture: NEBuffer™ 2 (NEB, B7202), 0.25 mM MnCl2 (SIGMA ...
-
bioRxiv - Genomics 2019Quote: ... The microRNA-Seq library was constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (Set 1) following the instructions provided by the manufacturer (NEB, E7300S/L, USA). The library construction was started with 800ng total RNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... The library preparation of the total RNA was performed with the NEBNext® Single Cell/Low Input RNA Library Prep Kit for Illumina (NEB #E6420S/L). Single read sequencing with a read length of 72 bp was performed on NextSeq ® 2000 System using the corresponding NextSeq2000 P3 Reagent Kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... four times the number of moles of the AdBcL (L = long) were annealed with 1x T4 DNA Ligase Reaction Buffer (New England Biolabs, Cat. no. B0201S) and heated to 94°C for 3 min ...
-
bioRxiv - Physiology 2023Quote: ... 300nmol-L of a gene specific primer (thermofisher scientific, USA) and 10uL of Syber green qPCR mastermix (New England Biolabs, Ipswich, Massachusetts, USA) each used as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... Immunoblotting was performed using HRP-conjugated anti-maltose binding protein (MBP) monoclonal antibody at 1:10000 dilution (New England Biolabs, #E8038) to verify equal expression levels of each construct.
-
bioRxiv - Cancer Biology 2023Quote: ... 14-3-3ζ with different conjugated molecules and BAD variants conjugated with mCitrine were subcloned to the multiple cloning site (MCS-2) using EcoRI and XbaI (NEB; # R0145S) and the MCS-1 using MluI-HF (NEB ...
-
bioRxiv - Genomics 2020Quote: ... Approximately 300 ng of genomic DNA was used to prepare DNA sequencing libraries for each parent following the protocol of NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB Cat No. #E7805S/L). The libraries were sent to Novogene (https://en.novogene.com/ ...
-
bioRxiv - Biophysics 2019Quote: ... The resulting product (typically 50 – 100 μL of 5 – 20 μM of protein) was mixed with an equimolar amount of SNAP-Surface 549 (New England Biolabs; 1 mM in DMSO) and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... The DAP gDNA library was prepared using the kit from NEBNext® DNA Library Prep Master Mix Set for Illumina® (NEB #E6040S/L). ZmIBH1-1 was fused to HaloTag using the kit from pFN19K HaloTag T7 SP6 Flexi Vecto (cat#G184A ...
-
bioRxiv - Bioengineering 2023Quote: ... All 5μl of the cell lysis were used for each Genomic PCR amplification using NEBNext® Ultra™ II Q5® Master Mix (NEB, M0544S). PCR program is 1 cycle ...
-
bioRxiv - Bioengineering 2021Quote: ... Antibodies used for targeted depletion were prepared using goat anti-rabbit magnetic beads (NEB, S1432S) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2020Quote: ... before being incubated with alkaline phosphatase-labeled anti-rabbit IgG (New England Biolabs, Beverly, MA).
-
bioRxiv - Neuroscience 2023Quote: ... The primary antibodies used were anti-PDGF-Ra (rabbit, New England Biolabs, 1:400 dilution), anti-APC (clone CC1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and purified using a pre-poured amylose column containing 4 mL amylose resin (New England Biolabs, E8021L) followed by size exclusion chromatography (protein buffer ...
-
bioRxiv - Molecular Biology 2021Quote: ... The RNA was first chemically fragmented (4 min) and then enzymatically treated with Antarctic Phosphatase (NEB#M0289S) and T4 Polynucleotide Kinase (NEB#M0201S) ...
-
bioRxiv - Immunology 2021Quote: ... 240 nM dT-primer* (Metabion, Planegg, Germany) and 4 U RNase Inhibitor (New England Biolabs, Frankfurt, Germany). Reverse transcription and addition of the template switch oligo was performed at 42 °C for 90 min after filling up to 10 μl with RT buffer mix for a final concentration of 1x superscript II buffer (Invitrogen) ...
-
Differential impact of a dyskeratosis congenita mutation in TPP1 on mouse hematopoiesis and germlinebioRxiv - Cell Biology 2021Quote: ... 5′ 32P-labeled (TTAGGG)4 oligonucleotide (labeled using [γ-32P]ATP and T4 PNK; New England Biolabs) was added ...
-
bioRxiv - Biochemistry 2020Quote: ... The second aliquot was incubated overnight at 37 °C with β1-4 galactosidase (New England Biolabs #P0745) using the same reaction conditions as the neuraminidase above ...
-
bioRxiv - Neuroscience 2022Quote: ... Gelated samples were digested in 4 U/ml proteinase K buffer (New England Biolabs, Ipswitch, MA, USA) with 50 mM Tris pH 8.0 (Serva ...