Labshake search
Citations for New England Biolabs :
251 - 300 of 10000+ citations for Tonsoku Like DNA Repair Protein TONSL Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... and NEBNext End repair/dA-tailing Module (New England Biolabs), and then barcoded using the Native Barcoding kit (Oxford Nanopore Technologies ...
-
On the causes, consequences, and avoidance of PCR duplicates: towards a theory of library complexitybioRxiv - Molecular Biology 2022Quote: ... and polished with an End Repair/dA-Tailing module (NEB). After subsequent purification ...
-
Evolution of protease activation and specificity via alpha-2-macroglobulin-mediated covalent capturebioRxiv - Synthetic Biology 2023Quote: ... A repair reaction was run using the PreCR kit (NEB) as described by the manufacturer followed by SPRI bead purification and elution in 51 µl ddH2O ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5′-hydroxyl group repair (T4 polynucleotide kinase (M0201L; NEB) were conducted on beads ...
-
bioRxiv - Genomics 2023Quote: ... and the NEBNext UltraII End Repair/dA-Tailing Module (NEB). ONT sequencing adaptors were then ligated to the DNA ...
-
bioRxiv - Microbiology 2021Quote: ... 30 ng of the sheared DNA were used for end-prep reaction using theNEBNext® Ultra™ II End Repair/dA-Tailing (E7546, New England Biolabs, USA). A double strand DNA fragment was formed by heating two oligonucleotides (NP_adapt_2_fw 5’ AAAGACAACCACGACTATAACGT 3’ and NP_adapt_2_rv 5’ CGTTATAGTCGTGGTTGTCTTT 3’ ...
-
bioRxiv - Genomics 2022Quote: ... Two hundred nanograms of DNA are end repaired and dA-tailed using NEBNext End repair/dA-tailing Module (E7546, New England Biolabs, Ipswich, Massachusetts, USA). The samples were then barcoded using EXP-NBD196 (barcodes 1–96 ...
-
bioRxiv - Genomics 2023Quote: ... Two libraries were prepared for Nanopore MinION sequencing using the Ligation Sequencing kit (SQK-LSK108, ONT, Oxford, UK) and NEBnext DNA Repair kit reagents (NEB, Ipswich, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... which were end-repaired (NEBNext end repair module (New England BioLabs)) and purified (Agencourt AMPure XP beads (Beckman Coulter Genomics)) ...
-
bioRxiv - Genomics 2022Quote: ... and NEBNext Ultra II end repair/dA-tailing Module (NEB E7546). This was done using 0.5-1.0 ug genomic DNA per sample and in accordance with the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Reactions were then treated with the NEBNext End Repair Module (NEB) following manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: Repair template plasmids were assembled using the NEBuilder HiFI Kit (NEB) from a combination of restriction digest fragments and PCR products ...
-
bioRxiv - Microbiology 2021Quote: ... the NEBNext Ultra II End Repair/dATailing module (E7546S, NEB, USA) was used to prepare 1000 ng DNA samples ...
-
bioRxiv - Immunology 2020Quote: ... for 1 hour and hydroxyl repair with T4 PNK (NEB, M0201S) for another 1 hour ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NEBNext Ultra II End Repair/dA-tailing Module (NEB, E7546S) was used before ligating Nanopore native barcodes (EXP-NBD104&114) ...
-
bioRxiv - Developmental Biology 2023Quote: ... A repair plasmid was made using NE Builder (New England Biolabs) that includes a 430bp gypsy insulator sequence (Geyer and Corces 1992 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and the NEBNext Ultra II End Repair/dA-Tailing Module (NEB), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... and processed with NEBNext End Repair and dA-Tailing Modules (NEB), and ligated to methylated Illumina Adaptors using NEBNext Quick Ligation Module (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... then treated with the End Repair/dA-Tailing Module (NEB, E7442L) and Ligation Module (NEB ...
-
bioRxiv - Genomics 2024Quote: ... and hydroxyl repair was performed using T4 Polynucleotide Kinase (PNK; NEB). Purified RNAs were subsequently ligated with the 5’ RNA adaptor (RA5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The fragmented DNA was enzymatically repaired and end-modified with adenosine (NEBNext® Ultra™ II End Repair/dA-Tailing Module, NEB, Ipswich, MA) and ligated (NEBNext® Ultra ™ II Ligation Module ...
-
bioRxiv - Molecular Biology 2020Quote: ... 70 μl of end-repair mix was added (1× Ligation buffer (NEB), 357 μM dNTPs ...
-
bioRxiv - Genetics 2019Quote: ... to perform the End Repair/dA-Tailing and Adaptor Ligation (NEB, E7337A) with a KAPA Hyper Prep Kit (KAPA ...
-
bioRxiv - Genomics 2021Quote: ... and the NEBNext Ultra II End-Repair/dA-tailing Module (E7546, NEB) followed by AMPure XP bead clean-up (A63882 ...
-
bioRxiv - Genetics 2020Quote: ... end repairing (End Repair Module #E6050L, New England Biolabs, Ipswich, MA, USA), cleaning (1 part DNA ...
-
bioRxiv - Genomics 2019Quote: ... followed by end-repair using the NEBNext EndRepair Module (New England Biolabs). Intramolecular circularization was achieved by overnight incubation at 16°C with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... and Illumina adaptor ligation mix [0.075x End repair reaction buffer (E6050, NEB), 0.32× Ligation master mix (E7595 ...
-
bioRxiv - Microbiology 2023Quote: ... End repair was performed following the manufacturer’s instructions and purified (NEB #E6050). C-tailing was performed with Terminal Transferase (NEB #M0315 ...
-
bioRxiv - Molecular Biology 2023Quote: ChIP-Seq libraries were prepared with NEBNext End Repair Module (NEB E6050S), A-tailing by Klenow Fragment (3’è5’ exo- ...
-
bioRxiv - Cancer Biology 2024Quote: ... and end-repair and ligation was performed using New England Biolabs (NEB) adapters ...
-
bioRxiv - Genomics 2024Quote: ... and the NEBNext UltraII End Repair/dA-Tailing Module (New England BioLabs) and followed by the sequencing adaptors ligation ...
-
bioRxiv - Genetics 2020Quote: ... followed by gap repair by adding 2 µl of 10× NEBuffer 2 (NEB), 3 µl of dNTPs (2.5 mM each ...
-
bioRxiv - Genomics 2021Quote: ... then 25μL of the end-repair mix (3.5X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 15μL of the end-repair mix (1X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 25μL of the end-repair mix (3.5X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... then 15μL of the end-repair mix (1X NEB ligation buffer (NEB B0202S), 17.5mM dNTP mix ...
-
bioRxiv - Genomics 2021Quote: ... and NEBNext Ultra II End repair/dA-tailing Module (E75460, New England Biolabs). Adapters were ligated using NEBNext Quick Ligation Module (E60560 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and end-repair dNTP mix (40uM dATP, 4uM dGTP, and 4uM dCTP; NEB) totaling 2 µL per reaction were added to perform end-repair and dA-tailing ...
-
bioRxiv - Genomics 2022Quote: ... tagmented samples were incubated in Repair Mix (0.1U Phusion-HF (New England Biolabs), 4U Taq DNA Ligase (New England Biolabs) ...
-
bioRxiv - Genomics 2022Quote: ... and 3’-adenylated with NEBNext Ultra II End Repair/dA-Tailing Module (NEB). The DNA was then purified with AMPure XP beads (Beckmann Coulter ...
-
bioRxiv - Genetics 2022Quote: ... Repair templates for homologous recombination were generated by PCR using Phusion polymerase (NEB) and purified genomic DNA as template or Taq polymerase (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... The linearized plasmids were treated with PreCR Repair Mix (M0309, New England Biolabs) and purified with the Monarch PCR & DNA Cleanup Kit (T1030 ...
-
bioRxiv - Microbiology 2023Quote: ... we used the NEBNext Ultra II End Repair/dATailing module (E7546S, NEB, USA) to prepare 1000 ng DNA from each sample ...
-
bioRxiv - Genomics 2023Quote: ... The NEB Next Ultra II End Repair/dA-tailing Kit (Cat#E7546, NEB) was utilized for end repair and dA addition ...
-
bioRxiv - Cell Biology 2023Quote: ... and the NEBNext UltraII End Repair/dA-Tailing Module (New England Biolabs; #E7546), and followed by the sequencing adaptors ligation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The repair template plasmid (pKK4) was assembled using the NEBuild HiFi Kit (NEB) from a combination of a restriction digest fragment and a synthetic gBlock Gene Fragment (IDT) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... using NEBNext Ultra II End repair/dA-tailing Module (New England Biolabs, USA) and NEB Blunt/TA Ligase Master Mix (New England Biolabs ...
-
bioRxiv - Genomics 2023Quote: ... End repair was performed in T4 ligase reaction buffer (New England Biolabs, NEB), 0.4mM of dNTPs ...
-
bioRxiv - Genomics 2023Quote: ... End repair was performed in T4 ligase reaction buffer (New England Biolabs, NEB), 0.4mM of dNTPs ...
-
bioRxiv - Genomics 2023Quote: ... and NEBNext End Repair/dA-Tailing Module (New England Biolabs, Ipswich, MA, USA). We cleaned the A-tailed fragments using 0.9X AMPure XP beads (Beckman Coulter ...