Labshake search
Citations for New England Biolabs :
451 - 500 of 10000+ citations for Thyroxine T4 ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... was hybridized to the 3’ adapter and the 5’ adapter ligated by adding 2μL T4 RNA ligase buffer (NEB), 5μL PEG 8000 (NEB) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR product was inserted into pcDNA3.1 via 5’EcoRI/3’NotI restriction digestion and a standard ligation protocol (T4 DNA Ligase; New England BioLabs) to create pcDNA3.1-Ncadherin ...
-
bioRxiv - Microbiology 2020Quote: ... and the 5’ ends of the DNA (25 nM) were radiolabeled using T4 polynucleotide kinase (PNK, New England Biolabs). Excess ...
-
bioRxiv - Microbiology 2021Quote: ... DNA oligonucleotides (Supplementary Table 2) were radiolabeled at the 5’ end by T4 Polynucleotide kinase (PNK) (New England Biolabs) treatment and [γ-32P] (PerkinElmer ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Cell Biology 2022Quote: ... the fragment and vector were mixed in a 5:1 ratio and ligated with T4 DNA Ligase (NEB, M0202L) overnight at 16°C ...
-
bioRxiv - Genetics 2023Quote: ... were ligated overnight at 20°C with a mix of six 5’ phosphorylated telorette oligonucleotides (0.1 µM each) and 2,000 units of T4 ligase (NEB Inc.) in a 50 µl reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... A linker RNA oligonucleotides purchased from IDT was preadenylated at 5’ -end by T4 RNA ligase I (NEB 0437) using a method described previously (30) ...
-
bioRxiv - Molecular Biology 2023Quote: ... then ligated to a custom 5′ adapter (10 μM oligocap) by T4 RNA Ligase I (M0437, New England Biolabs) with 1 μl RNaseOUT for 16 hours at 16°C ...
-
bioRxiv - Developmental Biology 2023Quote: ... After centrifugation the EtOH-precipitated fragments were resuspended in water and ligated to 0.25 µM randomized 5’ RNA adapter using T4 RNA ligase 1 (NEB) in the same buffer conditions as described above ...
-
bioRxiv - Neuroscience 2023Quote: ... Ligation of 5’ adaptor to already 3’ ligated RNA product was performed with T4 RNA ligase 1 (NEB, #EL0021) at 37°C for 1 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... Beads were subsequently resuspended in 20 μL dephosphorylation reaction mix (1X PNK buffer, pH 6.5, 5 units of T4 polynucleotide kinase (New England Biolabs), 0.5 μL RNaseOut Ribonuclease inhibitor (Fisher Scientific) ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs, #M0204). To reduce ligation biases ...
-
bioRxiv - Molecular Biology 2023Quote: ... A 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT) was then ligated to RNAs to the product using T4 RNA ligase 1 (NEB) for 4 hours at 15°C ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmid pEC095 was digested with BtsBI and the 5’ overhanging DNA ends were filled in with T4 Polymerase (NEB). A kanamycin resistance marker ...
-
bioRxiv - Genomics 2019Quote: ... single-stranded sgRNA oligos were annealed using T4 PNK in T4 ligation buffer (both NEB), and ligated into digested (BsmBI ...
-
bioRxiv - Biophysics 2023Quote: ... each primer pair was annealed and consequently phosphorylated with T4-polynucleotide kinase (T4-PNK; NEB). Restriction digestion of the pLentiCRISPRv2 vector was performed using FD-Esp3I (Thermo ...
-
bioRxiv - Genomics 2023Quote: ... resuspended with T4 DNA ligation mastermix (40 µl of T4 DNA Ligase Reaction buffer (NEB), 10% Triton X-100 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3’ RNA adaptor (/ 5Phos/NNNNNNNNGAUCGUCGGACUGUAGAACUCUGAAC/3InvdT/) is ligated at 5 μM concentration for 1 hours at room temperature using T4 RNA ligase (NEB), followed by 2 consecutive streptavidin bead bindings and extractions ...
-
bioRxiv - Molecular Biology 2021Quote: ChIP sequencing libraries were built from immunoprecipitated DNA by first end repairing the DNA with 5 µL T4 DNA polymerase (NEB), 5 µL T4 PNK (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Supplementary Table 7) were ligated to 5 μg of total RNA using 10 U of T4 ssRNA Ligase 1 (NEB) in a final volume of 50 μl for 1 h at 37°C and 1X T4 of RNA Ligase Reaction Buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was eluted from the beads via phenol extraction or heating in water at 80oC for 5 min and ssDNA adapter [Phos]CCACGCGTGCCCTATAGTCGC[Ami] was ligated using T4 RNA ligase (NEB). Libraries were amplified and barcoded via nested and tagged PCR following the original protocol (47 ...
-
bioRxiv - Genomics 2019Quote: ... RNA was resuspended and γ-ATP was added to the 5’ end of the RNA with T4 polynucleotide kinase (NEB) for 30min at 37°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The purified construct was then inserted at the 5’ end of the Fluc coding sequence with T4 DNA ligase (New England BioLabs). The resulting vector was termed Were-1-Fluc (Table 1).
-
bioRxiv - Molecular Biology 2019Quote: Different CpG-containing oligonucleotides with 5’-TTAA overhangs were annealed and end-to-end ligated overnight at 16°C with T4 ligase (NEB). Oligos were ethanol-precipitated and filled-in with 1 mM biotinylated dUTP (Thermo Fisher ...
-
bioRxiv - Plant Biology 2019Quote: ... The circularization of DNase treated total RNAs was performed by intramolecular ligation of 5’ and 3’ ends using 40U of T4 RNA ligase (New England Biolabs) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... fragmented nascent RNA was dissolved in H2O and incubated with 10 pmol of reverse 3’ RNA adaptor (5’p-rNrNrNrNrNrNrGrArUrCrGrUrCrGrGrArCrUrGrUrArGrArArCrUrCrUrGrArArC-/3’InvdT/) and T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ RNA linker (20 µM) (Dharmacon, 5’-phosphate-AGAUCGGAAGAGCGGUUCAG-3’ was added by T4 RNA Ligase 1 (NEB M0204) at 16°C overnight ...
-
bioRxiv - Biophysics 2019Quote: ... Both the 2 kb spacer and 1.5 kb biotin handle DNA were ligated to 5’-CGGT 1 µm polystyrene oligo beads overnight at 16 °C using T4 DNA ligase (NEB). The ligated beads were first washed with TE + 0.5 M KCl + 20 µg/mL β-casein ...
-
bioRxiv - Systems Biology 2020Quote: ... we first phosphorylated the 5’ ends of each probe set by combining 4 μL of the pooled oligos with 1 μL T4 PNK (NEB), 20 μL T7 DNA ligase reaction buffer (NEB) ...
-
bioRxiv - Microbiology 2020Quote: ... The fluorescently labeled fragment was combined with the 5′ and 3′ unmodified RNAs by DNA-splinted RNA ligation using T4 DNA ligase (New England Biolabs) and purified by denaturing polyacrylamide gel electrophoresis ...
-
bioRxiv - Microbiology 2020Quote: ... 3-5 μg of RNAse H treated RNA was circularized using T4 RNA ligase 1 (ssRNA Ligase, New England Biolabs), RNA was extracted with phenol/chloroform approach and ethanol precipitated ...
-
bioRxiv - Biophysics 2020Quote: ... Each mix was incubated at 90°C for 5 min and annealed in 1x T4 DNA Ligase Reaction Buffer (B0202S; NEB) by gradual cooling ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sRNA fraction (∼15- 35nt) was isolated by gel extraction and RNA species bearing 5’-OH were monophosphorylated by T4 polynucletide kinase (NEB). This was followed by treatment by a terminator exonuclease (Epicentre) ...
-
bioRxiv - Cell Biology 2022Quote: ... A 3’ RNA adapter /5’Phos/rArGrArUrCrGrGrArArGrArGrCrArCrArCrGrUrC/3’SpC3 was ligated to the samples using T4 RNA Ligase (NEB, M0437M) at room temperature for 75 min.
-
bioRxiv - Microbiology 2022Quote: ... single-stranded adaptors (5’-Phos – ATCCACAACAACTCTCCTCCTC – 3’) were linked to the AdSDV genome segments using T4 RNA ligase I (New England Biolabs). Using the reverse adaptor primer paired with another primer ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5’ RNA linkers with four terminal random nucleotides were then ligated to the small RNAs using T4 RNA ligase (NEB) followed by an SPRI magnetic bead purification (in-house-produced beads similar to Agencourt RNAclean XP) ...
-
bioRxiv - Molecular Biology 2019Quote: ... the RNA was mixed with 10 µM of custom 5’ adapter and the ligation reaction was done using T4 RNA ligase 1 (M0437M, NEW ENGLAND BIOLABS) and with RNasin Plus ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 5’ ends of ds-probes were radioactively labelled with [ψ-32P]-ATP using T4 polynucleotide kinase (New England Biolabs), purified on Illustra Microspin G-25 columns (GE) ...
-
bioRxiv - Genetics 2021Quote: ... 5’TTGGNNN…NNNGTTTAAGAGC3’and Oligo R: 5’TTAGCTCTTAAACNNN…NNNCCAACAAG3’) and ligating them together with the linearized vector using the T4 DNA ligase enzyme (NEB).
-
bioRxiv - Physiology 2021Quote: ... A K13 propeller domain-specific guide gRNA was introduced into this vector at the BbsI restriction sites using the oligo pair p1+p2 (Supplementary file 5) using T4 DNA ligase (New England BioLabs). Oligos were phosphorylated and annealed prior to cloning ...
-
bioRxiv - Biochemistry 2021Quote: ... The tested interference substrates of either target strand (TS) or non-target strand (NTS) were 5′-radiolabeled with T4 PNK (NEB) in the presence of gamma 32P-ATP ...
-
bioRxiv - Biochemistry 2021Quote: ... The reaction was then supplemented with 5 mM DTT and the same concentrations of T4 polynucleotide kinase (New England BioLabs) and [γ-32P]-ATP (PerkinElmer ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA (50 pmol) was radiolabelled at 5′ end with by using 10 units of T4 polynucleotide kinase (New England Biolabs) mixed to 3 μl of γ32P-ATP (3000 Ci/mmol 10 mCi/ml ...
-
bioRxiv - Immunology 2021Quote: ... 3’ arm of homology to exon 5 was cloned into BamH1-NotI-digested PL451 (contains Neomycin cassette and loxP; NCI Frederick) using T4 DNA Ligase (NEB). Third ...
-
bioRxiv - Genomics 2020Quote: ... RNA was ligated overnight at 16°C at 5’ with DNA/RNA chimeric oligonucleotide adaptor (TCAGACGTGTGCTCTTCCGATCTrNrNrWrNrNrWrNrN, TIF2-RNA in Supplementary Table S1 using T4 RNA ligase (NEB) in the presence of 10% dimethylsulphoxide (DMSO) ...
-
bioRxiv - Genetics 2022Quote: ... The resulting monophosphorylated RNAs were ligated to the 3’ adaptor (5’rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 in the presence of 25% PEG8000 (NEB) at 15 °C overnight ...
-
bioRxiv - Molecular Biology 2022Quote: ... on-bead decapping and phosphorylation were performed in a 30 μl reaction with 5 units T4 PNK 3’ phosphatase minus (NEB), 2.25 μg GST-Dcp1-Edc1-Dcp2 ...