Labshake search
Citations for New England Biolabs :
51 - 100 of 110 citations for Thrombopoietin TPO Mouse CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: Mouse NIK coding sequence in the pENTR shuttle plasmid was mutated using Phusion high fidelity polymerase (NEB) and oligonucleotides designed to carry the desired mutations (indicated by lowercase letters) ...
-
bioRxiv - Biochemistry 2023Quote: ... Bound protein was detected by western blot using mouse anti-MBP diluted 1:10,000 (New England Biolabs), fluorescent secondary antibodies (Li-Cor Biosciences) ...
-
bioRxiv - Microbiology 2024Quote: ... and libraries were prepared using the NEBNext rRNA Depletion Kit for Human/Mouse/Rat (NEB Cat#E6310). Adapter-ligated cDNA was amplified with 11 cycles of PCR to generate libraries ∼300 bp in length ...
-
bioRxiv - Neuroscience 2024Quote: Blood corticosterone levels were measured using the Mouse corticosterone Enzyme-linked immunosorbent assay (ELISA) kit (BIOLABS, USA) by collecting blood from wild-type mice ...
-
bioRxiv - Bioengineering 2024Quote: ... Amplicons from mouse embryo lysates were generated using Q5 Hot Start High-Fidelity 2x Mastermix (M0492, NEB) in a 25 μL reaction ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Plant Biology 2021Quote: ... or anti-MBP antibody (1:10.000, used with 1:10.000 secondary horseradish peroxidase-conjugated anti-mouse antibody; NEB).
-
bioRxiv - Neuroscience 2022Quote: ... CREB (CCDS15005.1) and CRTC1 (CCDS40372.1) were amplified from mouse brain cDNA library by primers contain AgeI-HF (R3552L, NEB) and BamHI-HF (R3136L ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
Evaluation of the OsTIR1 and AtAFB2 AID systems for chromatin protein degradation in mammalian cellsbioRxiv - Molecular Biology 2021Quote: ... mCapH2 (Gene ID: 52683) genes were PCR amplified from human and mouse genomic DNA with Q5 polymerase (NEB). The lengths of homology arms are featured in electronic supplementary material Table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Neuroscience 2024Quote: Mouse Hapln1 (NM_013500) was cloned into the pAAV vector by PCR with the following primers and ligase (NEB) or In-Fusion cloning (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 75°C) with 0.5 μg mouse Cot-1 DNA supplemented with 10 mM vanadyl ribonucleoside complex (VRC) (NEB, S1402S) and 0.2 U μL−1 RNAseOUT (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... elegans and mouse cDNA (PolyATtract® mRNA Isolation Systems, Promega and ProtoScript® First Strand cDNA Synthesis Kit, NEB). Detailed sub-cloning information is available upon request.
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Biochemistry 2023Quote: ... The coding sequence of mouse PADI4 (residues 1-666) was amplified and cloned into pET28a vector using NdelI (NEB) and XhoI (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Bound antibodies were detected by incubation with anti-rabbit or anti-mouse DyLight 800-conjugated secondary antibodies (New England BioLabs). Slide images were acquired using an InnoScan 710-IR scanner (Innopsys ...
-
bioRxiv - Immunology 2021Quote: ... A mouse SUV39H1 gBlock was synthesized (IDT) and cloned into AgeI/BSpEI-digested pL-SFFV-RFP using Gibson assembly (NEB) for 1hour at 50°C ...
-
bioRxiv - Cell Biology 2022Quote: The DNA sequence coding for full length of p21 and Cyclin B1 was amplified from mouse cDNA by PCR using Phusion high-fidelity DNA Polymerase (New England BioLabs) and cloned in frame into Ch plasmid with AsiSI and NotI restriction endonucleases (New England BioLabs) ...
-
bioRxiv - Genomics 2020Quote: ... The protocol started with tissue pre-permeabilization (30 min at 33°C for mouse brain) with addition of 120μl reagent per well of exonuclease I buffer (NEB, USA). In case spleen sections were processed ...
-
bioRxiv - Neuroscience 2019Quote: ... Secondary antibodies used were: Alexa-680 goat anti-mouse IgG and Alexa-800 goat anti-rabbit IgG (New England Biolabs). For DRGN cultures ...
-
bioRxiv - Molecular Biology 2019Quote: Libraries were prepared with NEBNEXT rRNA Depletion kit (human/mouse/rat) and NEBNEXT Ultra II Directional RNA Library Prep kit for Illumina (New England Biolabs) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: The CAG-HA-RBMS3-PCDH cDNA expression plasmid was cloned using a cDNA template made from RNA from the lungs of a wild-type mouse using the Q5 polymerase (NEB) and restriction endonuclease cloning with the following primers ...
-
bioRxiv - Neuroscience 2021Quote: ... One piece of mouse frontal cortex tissue (6-10 mg) was placed in 3 ml of ice-cold nuclei extraction buffer (NEB) [0.32 M sucrose ...
-
bioRxiv - Developmental Biology 2021Quote: Subcloning Both full-length and truncated (1-160) mouse Naa12 were amplified from the pMAL-c5x Naa12 plasmid using Q5 HF Master Mix (NEB), AAAACCCGGGTATGAACATCCGCCGGGCTCGGC as the forward primer ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Cell Biology 2019Quote: ... Standard qualitative PCRs to check for the general abundance of distinct SPIRE1 splice variants were performed employing cDNAs from mouse brain tissue and Q5 High-Fidelity DNA polymerase (New England Biolabs). Expression vectors encoding mouse SPIRE1 ...
-
bioRxiv - Immunology 2020Quote: ... Single antigen specific memory B cells were sorted on BD FACS Aria II into 96-well PCR plates (Axygen) containing 10 μl per well of lysis buffer (10 mM DPBS, 4 U Mouse RNase Inhibitor, NEB). Plates were immediately frozen on dry ice and stored at 80 C or processed for cDNA synthesis.
-
bioRxiv - Neuroscience 2023Quote: ... To generate these constructs gene block fragments that codify for those sequences were produced in the Duke Transgenic Mouse Facility and cloned into the backbone using EcoRI-HF Restriction Enzyme (NEB) and In-Fusion HD Cloning Kit (Takara ...
-
bioRxiv - Immunology 2023Quote: ... The custom sgRNA vector used in this study was a hybrid AAV-SB-CRISPR plasmid for targeting primary mouse NK cells (AAV-SB100x) that was constructed by gBlock fragments (IDT) followed by Gibson Assembly (NEB). The Surf-v2 library was cloned into the AAV-SB-CRISPR vector by pooled cloning to generate the AAV-SB-Surf-v2 plasmid library.
-
bioRxiv - Molecular Biology 2023Quote: ... The corresponding regions of a partial mouse Azin1 gene were amplified from mouse tail genomic DNA by using Phusion Hot Start Flex 2X Master Mix (New England Biolabs) and the following primers ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Immunology 2024Quote: N-linked glycans were enzymatically released from purified mouse THP using PNGase-F kit (catalog no P0709S, New England Biolabs). N-glycans were then purified from the reaction mixture containing denaturing buffer and de-N-glycosylated proteins by solid phase extraction method using Sep-Pak C18 (1 cc Vac-cartridges ...
-
bioRxiv - Microbiology 2024Quote: ... AnTat1.1 sequence was obtained from AnTat1.1 specific cDNA from mouse infection D6 cloned into a pMiniT vector with the PCR Cloning Kit (NEB, E1202S). VSG-228 was partially amplified from VSG PCR (see below ...
-
bioRxiv - Immunology 2021Quote: Point or deletion mutations were prepared from human or mouse CRT expression clones in pCMV3-C-Myc (SinoBiological) using the Q5® Site-Directed Mutagenesis Kit (NEB) according to the manufacturer’s protocol and primers designed using the NEBaseChanger™ web tool ...
-
bioRxiv - Systems Biology 2020Quote: ... rRNA depletion and library preparation for sequencing was completed with the NEBNext protocol (‘Protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760 ...
-
bioRxiv - Neuroscience 2021Quote: The moPrP-eGFP_39/40 fusion construct carrying eGFP within the flexible N-terminal tail between aa 39 and 40 of mouse PrP was created using NEB® Golden Gate Assembly (New England Biolabs). In brief ...
-
bioRxiv - Cancer Biology 2020Quote: ... we performed eight 100 μl PCR reactions per sample (4 μg DNA per reaction, 32 μg per mouse) using Q5 High-Fidelity 2x Master Mix (New England Biolabs, M0494X). The PCR products were purified with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genomics 2022Quote: ... DNA fragments ranging from 3 kb to 5 kb with 40-100 bp terminal homologies were amplified from mouse BAC RP23-51O13 with Q5 polymerase (NEB, M0491L). Approximately equal amount (100 ng ...
-
bioRxiv - Immunology 2020Quote: CAR-encoding mRNA was transcribed from linearized plasmids encoding anti-human CD19 CAR61 and anti-mouse CD19 CAR71 using T7 RNA polymerase (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs). The mRNAs were transcribed to contain the 5′ UTR derived from the human a-globin 5′ leader RNA ...
-
bioRxiv - Genetics 2020Quote: ... RNA-seq libraries were prepared according to the protocol for use with NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6310) and NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB #E7760) ...
-
bioRxiv - Systems Biology 2023Quote: ... Signals following a 1h incubation at room temperature with the appropriate HRP-conjugated secondary antibodies (anti-mouse NEB 7076S or anti-rabbit NEB 7074S) were acquired using the Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Immunology 2023Quote: ... Ribosomal RNA from 1000 ng total extracted RNA was depleted using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat; New England Biolabs Inc.). The remaining RNA was used to produce the sequencing libraries using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs Inc. ...
-
bioRxiv - Genomics 2023Quote: Mouse tail (1cm) was used to extract the genomic DNA (gDNA) using NEB Monarch® Genomic DNA Purification Kit (NEB T3010L). DNA concentration was measured on Qubit dsDNA BR assay kit (cat ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were washed three times with a PBS buffer 1X and then incubated with mouse anti-MBP (NEB, Cat# E8032L) or rabbit anti-V5 (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2021Quote: DNAse-treated RNA with high RIN value was used to deplete ribosomal RNA using NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E6350) as per manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: For Southern blot analysis 150 ng of mouse DNA was digested with 10 units of BamHI-HF (NEB, Figure 2 and 5), NdeI (NEB ...