Labshake search
Citations for New England Biolabs :
351 - 400 of 1263 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2019Quote: ... and 3’-A-tailed with NEBNext dA-Tailing Module (NEB) following the recommendations of the manufacturer ...
-
bioRxiv - Genomics 2020Quote: ... 3 mM DTT 8 μl Large Klenow Fragment (NEB, #M0210L) and 2 μl T4 PNK (NEB ...
-
bioRxiv - Microbiology 2020Quote: ... gDNA (3 μg) was digested by HpaII (New England Biolabs) at 37°C for 1 hr ...
-
bioRxiv - Biochemistry 2021Quote: ... and 40 U of β1-3 Galactosidase (New England Biolabs) for 16 h at 37°C.
-
bioRxiv - Cancer Biology 2020Quote: ... 5 units of Klenow Fragment (3’à 5’ exo-, NEB), CutSmart buffer (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA (3 μg) was treated with DNase (New England Biolabs) and reverse transcribed using random primer mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2-3 ×106 cells were treated with MNase (NEB M0247) ranging from 10-30 Kunitz U in 800 μl of custom buffer (Tris-HCl pH 7.5 10 mM ...
-
bioRxiv - Genomics 2023Quote: ... and 7.5 U of Klenow fragment 3’→5’ exo-(NEB), except for input DNA that is degraded (e.g. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 µL Ultra II End-prep enzyme mix (NEB, E76468). The mixture was incubated at 20 °C for 5 minutes and 65 °C for 5 minutes ...
-
bioRxiv - Genetics 2023Quote: ... 1 μl T4 PNK (3′ phosphatase minus, New England BioLabs)) ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 μL of Klenow Fragment (3’ -> 5’ exo -, NEB M0212L), 5 μL 50% PEG 8000 ...
-
bioRxiv - Cell Biology 2023Quote: ... using Large Klenow fragment 3’-5’ exo- (New England Biolabs). Biotinylated 19x 601 array DNA ...
-
bioRxiv - Genomics 2023Quote: ... by using Klenow Fragment (3′→5′ exo-) (New England Biolabs) for 30 min at 37 °C and purified by using a QIAquick PCR Purification Kit ...
-
bioRxiv - Molecular Biology 2023Quote: ... A-tailing by Klenow Fragment (3’è5’ exo-; NEB M0212S), and TruSeq 6-bp index adaptor ligation by Quick ligase (NEB M2200S) ...
-
bioRxiv - Genomics 2023Quote: ... 3 μL NEBNext Ultra II End Prep Enzyme Mix (NEB), and nuclease-free water (NFW) ...
-
bioRxiv - Genomics 2023Quote: ... 3 uL of 10x T4 ligase buffer (New England Biolabs), 75 ng destination vector ...
-
bioRxiv - Microbiology 2023Quote: ... 3 μL containing 0.01 U Bst 2.0 DNA polymerases (NEB), 0.5 U SplintR ligase (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... The 3 library pools were purified by an ExoSAPII (NEB) reaction to remove single-stranded DNA and further by column purification (MiniElute Gel Extraction Kit ...
-
bioRxiv - Genomics 2023Quote: ... The APOBEC reaction mix (3 μL APOBEC reaction buffer (NEB), 0.3 μL APOBEC (NEB) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µl of Klenow Fragment (3′→5′ exo-, NEB, M0212S), 3 µl of T4 polynucleotide kinase (NEB ...
-
bioRxiv - Molecular Biology 2024Quote: ... ∼500 bp 5’ and 3’ flanking regions of Tb427.10.12290 (NEB) with primers SMD400/1 and SMD404/5 respectively using (Lister strain 427 ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µl Ultra II end prep enzyme mix (NEB), and incubated at 20 °C for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3’ ends were dephosphorylated using T4 PNK (NEB, M0201). DNA ends were then blunted using T4 DNA polymerase (NEB ...
-
bioRxiv - Genomics 2024Quote: ... followed by 3′ adapter ligation using T4 RNA ligase (NEB). Biotinylated RNAs were enriched for a second time ...
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Neuroscience 2021Quote: The expression clone for both the peptide of interest and the control was transformed into competent DH5α cells (NEB® [New England Biolabs] 5-alpha Competent E ...
-
bioRxiv - Immunology 2019Quote: ... activated and transduced T cells were incubated with GXR-B27 cells pulsed with the indicated peptide concentrations for 6 hours in presence of Brefeldin A (NEB; 420601). The cells were stained with anti-LNGFR-PE ...
-
bioRxiv - Molecular Biology 2022Quote: ... pH 8.0 and adding 2ul/5-10mg dry weight (DW) of PNGaseF (Peptide-N-Glycosidase F) (New England Biolabs, Cat. #P0704S). Samples were incubated with continuous agitation at 150 rpm (Stuart Horizontal Shaker ...
-
bioRxiv - Molecular Biology 2023Quote: ... peptide sequences specific to an aMino sdAb were generated using the Ph.D.™-C7C Phage Display Peptide Library Kit (New England BioLabs, E8120S), a combinatorial library consisting of randomized display peptides with a disulphide constrained loop (AC-XXXXXXX-CGGGS ...
-
bioRxiv - Biochemistry 2020Quote: ... and peptides in one aliquot were deglycosylated by further treatment with 125 U of Peptide-N-Glycosidase F (PNGase F) (New England BioLabs, MA, USA) for 16 h at 37 °C.
-
bioRxiv - Cell Biology 2021Quote: ... were made by cloning synthetic gene fragments encoding the CBS or TAT peptide sequences into NdeI and BamHI sites in pMAL-c5x (New England Biolabs, Ipswich, MA). The encoded cargo proteins thus have either a CBS or TAT sequence C-terminal to the MBP and a 6x His tag beyond.
-
bioRxiv - Microbiology 2020Quote: ... 25 μg of protein was precipitated from cell lysate as described in Methods and treated with peptide-N-glycosidase F (PNGase F; New England Biolabs, MT, USA) according to the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2021Quote: ... behind the α-factor signal peptide sequence using SmaI/EcoRI restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, MA, USA). Here ...
-
bioRxiv - Neuroscience 2021Quote: ... with 1% (w/v) octylglucoside containing 5 U endoglycosidase H (Endo H) or peptide: N-glycosidase F (PNGase F; both NEB, Frankfurt, Germany) at 37°C for 1 h ...
-
bioRxiv - Microbiology 2024Quote: ... GST-IpaH4-3XFlag was cloned into pGEX6P-1 with a 3XFlag peptide followed by the coding sequence for ubiquitin using Gibson Cloning (NEB; Table S4). Sequence-verified constructs were transformed into E ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 3 uL of Taq polymerase (New England BioLabs, Ipswich, MA, USA), 1 uM of 50 mM MnCl2 ...
-
bioRxiv - Cell Biology 2020Quote: H4-SNAP histones were labelled with 3 μM TMR fluorophore (NEB) for 30 min in complete medium ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 µl of 10x NEBuffer 3 (cat#B7003, New England Biolabs), and 13 µl of water were incubated in a thermocycler (cat#EP950040025 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’-triphosporylated RNA was capped with 3’-desthiobiotin-TEG-GTP (NEB)) using the Vaccinia virus Capping enzyme (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... then free 3 adaptors were degraded using 5 deadenylase (NEB, M0331) and RecJf (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3 μL of 20 mg/mL Proteinase K (NEB EO0491) was added to each sample ...
-
bioRxiv - Microbiology 2020Quote: ... and 3’-end dephosphorylated by 10 U T4-PNK (M0201S, NEB) in the presence of 20 U RNase inhibitor (M0314L ...
-
bioRxiv - Microbiology 2020Quote: ... For 3’ adaptor ligation the NEBNext Small RNA Kit (E7560S, NEB) was used ...
-
bioRxiv - Molecular Biology 2019Quote: ... 3 μl of USER enzyme (New England Biolabs; cat. no. M5505) were mixed with 16 μl of adapter-ligated DNA ...
-
bioRxiv - Molecular Biology 2019Quote: ... for 3-6 hours in 20 μl 1x CutSmart buffer (NEB), 0.2 μl was quantified using PicoGreen DNA (Life Technologies) ...
-
bioRxiv - Bioengineering 2019Quote: Single stranded plasmid master mix (3x): 3 U/µL Nb.BbvCI (NEB), 36 U/µL Exonuclease III (ExoIII ...
-
bioRxiv - Immunology 2021Quote: ... and 375 U/mL of Klenow Fragment (3’-5’ exo-) (NEB). After cDNA synthesis and subsequent purification by AMPure XP (Beckman Coulter) ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μl (0.5 μl per sample volume) of RNase If (NEB) was added and the sample was incubated at 37 °C for 15 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 3 µL 10% SDS and 1.8U Proteinase K (NEB), and incubated for 1 hour at 50°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1.5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) and 1.5 µ l of T4 Polynucleotide Kinase (NEB ...