Labshake search
Citations for New England Biolabs :
151 - 200 of 2219 citations for SARS CoV 2 Spike N Terminal Domain NTD Sheep Fc Tag HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 10 U Terminal Transferase (NEB) and ddH2O to a volume of 50 µl ...
-
bioRxiv - Cell Biology 2022Quote: ... was fused to an HA-tag at its N-terminus during PCR and cloned into the lentiviral vector pLJM1 linearized with AgeI (NEB) and EcoRI (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... To produce the ABI1 Isoform 2 deleted SH3 domain we performed Q5 site-directed mutagenesis (New England Biolabs Inc.) with forward primer 5’-TAGCTCGAGGTTAACGAATTC - 3’ and reverse primer 5’-TTTCTCAATATAATTCTTGGGG - 3’ synthesized by IDT and then verified the sequence (Genewiz) ...
-
bioRxiv - Biophysics 2021Quote: ... was generated by subcloning Mdn1 aa4381-4717 into pSNAP-tag(T7)-2 (NEB N9181S) downstream of the SNAP tag ...
-
bioRxiv - Developmental Biology 2020Quote: ... Terminal deoxynucleotidyl transferase (New England Biolabs) was then used to conjugate ATTO 633-ddUTP to the 3’ ends of oligonucleotides that had been purchased from IDT ...
-
bioRxiv - Genetics 2020Quote: ... 4 Units of terminal transferase (NEB) were added together with dCTP in a final concentration of 0.1 mM ...
-
bioRxiv - Molecular Biology 2020Quote: ... and terminal transferase (New England Biolabs). For fluorescent substrates ...
-
bioRxiv - Bioengineering 2024Quote: ... using terminal deoxynucleotidyl transferase (TdT) (NEB). This reaction was carried out in 1× TdT buffer ...
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Biophysics 2022Quote: ... CLIP-tag (NEB), and HaloTag (Promega ...
-
bioRxiv - Biochemistry 2021Quote: ... To release N-glycans 2 μl of PNGase F (New England Biolabs) was added and the samples were incubated for 18 h in 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 1 unit/μl Terminal Transferase (NEB). The DNA was incubated at 37 °C for 30 min ...
-
bioRxiv - Genomics 2023Quote: ... 0.2 U/μl Terminal Transferase (NEB, M0315L)) and incubated at 37 °C for 20 min ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... SNAP-tag (P9310S, NEB), and β-tubulin (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP tag (NEB, P9310S) or GFP (MPI-CBG ...
-
bioRxiv - Biophysics 2020Quote: SNAP-tag ligands (NEB): SNAP-Cell TMR-star ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Genomics 2020Quote: ... Beads containing the ssDNA extension products were suspended in 10 μl of polyadenylation master mix containing 2 units of terminal transferase TdT (New England Biolabs), 1x TdT buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... grk-2 cDNA corresponding to the C-terminal GRK-2 fragment was amplified from a mixed-stage N2 cDNA library using Q5 high-fidelity DNA polymerase (NEB) with gene-specific primers ...
-
bioRxiv - Biophysics 2020Quote: ... for the substrate-binding domain mutants and βamHI-AlwnI (NEB) for the transmembrane domain mutants (Appendix) ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of 0.1 M Dithiothreitol (cat. n° M0368L, NEB, New England Biolabs, USA), 1 µL of 10 mM dNTP (cat ...
-
bioRxiv - Synthetic Biology 2019Quote: ... in 1X terminal transferase reaction buffer (NEB, M0315L) and 0.25 mM CoCl2 (NEB ...
-
bioRxiv - Genetics 2021Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... using a terminal transferase (New England BioLabs, M0315S) as described previously.[21] Briefly ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 units Terminal Transferase (New England Biolabs™) and were carried out at 37°C for 30 minutes followed by heat inactivation at 75°C for 10 minutes ...
-
bioRxiv - Microbiology 2022Quote: ... 5 µL terminal transferase (TdT) (NEB, CN M0315L). The reaction was incubated at 37 °C for 1 hour ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.4 U/μL Terminal Deoxynucleotidyl Transferase (NEB) were mixed in 1× Terminal Transferase Reaction buffer and incubated at 37°C overnight ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S R403T and RaTG13 S T403R/T403A mutant plasmids were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Molecular Biology 2020Quote: ... then incubated for 2 h at 37°C in 100 μl 1x TdT buffer containing 4 μl 10 mM ATP and 2 μl Terminal Transferase (NEB M0315L). Plugs were rinsed with 1 ml tris buffer (10 mM Tris HCl pH 8.0) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The SNAP-tag sequence (NEB) was cloned into a β-cell-specific expression vector with a porcine INS gene promoter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
bioRxiv - Molecular Biology 2023Quote: The kinase domain variant library was digested with PstI-HF (NEB) and NdeI-HF (NEB ...
-
bioRxiv - Immunology 2022Quote: ... Delta and BA.2 spike plasmids were linearized by restriction enzymes and transcribed to mRNA by in vitro T7 RNA polymerase (NEB, Cat # E2060S) as previously described10.
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Genomics 2020Quote: ... in 1× terminal deoxynucleotidyl transferase buffer (New England Biolabs). 2.5 fmol of a 50-nucleotide oligomer was included in all reactions as an internal control ...
-
bioRxiv - Microbiology 2023Quote: ... C-tailing was performed with Terminal Transferase (NEB #M0315) and 400-800 ng of end repaired gDNA using a 1:20 dCTP:ddCTP mixture (9.5 mM dCTP Millipore Sigma #3732738001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1U of terminal transferase (New England Biolabs #M0315L). The reaction was incubated at 37°C for five minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... and 20 U/μL terminal transferase (NEB, no. M0315S). After incubation at 37°C for 30 min and termination at 70°C for 10 min ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Immunology 2021Quote: ... 2 µL of random primer mix 60 µM (cat. n° S1330S, NEB, New England Biolabs, USA) and 4.8 µL of nuclease-free water ...
-
bioRxiv - Biochemistry 2022Quote: DNMT3A PWWP domain was expressed in BL21(DE3) cells (New England Biolabs) using the same protocol as above ...
-
bioRxiv - Biophysics 2019Quote: ... SNAP-tag (New England Biolabs Inc.), FLAG-tag and 6 × His-tag were attached at the C-terminal ...