Labshake search
Citations for New England Biolabs :
51 - 100 of 1991 citations for SARS CoV 2 Spike Glycoprotein S1 RBD Fc Tag CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Microbiology 2021Quote: ... cell lysates were mixed with glycoprotein denaturing buffer (New England Biolabs) and incubated at 100 °C for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... The lysates were sonicated and denatured with Glycoprotein Denaturing Buffer (NEB) by heating them at 100°C for 10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.2 μM primers (primer sequences are presented in Table S1) and 2 × PCR Master mix (M0482S, NEB), with the following cycling parameters ...
-
bioRxiv - Molecular Biology 2022Quote: ... and the L3 DNA linker (Table S1) was ligated to RNA by T4 RNA Ligase 2 (NEB). The beads were washed with high salt buffer and PNK buffer ...
-
bioRxiv - Microbiology 2023Quote: ... was amplified from JE2 using the primer pair 3810/9647 and the snap-tag coding sequence amplified from pSNAP-tag (T7)-2 (New England Biolabs, NEB; Supplementary Information) using the primer pair 9631/9632 ...
-
bioRxiv - Biochemistry 2022Quote: ... 1200 μg protein was mixed with 15 μL Glycoprotein Denaturing Buffer (NEB) in 150 μL total volume and incubated at room temperature for 10 min ...
-
bioRxiv - Microbiology 2023Quote: ... the isolated glycoproteins are treated by α-2,3/6/8 neuraminidase (NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... was generated by subcloning Mdn1 aa4381-4717 into pSNAP-tag(T7)-2 (NEB N9181S) downstream of the SNAP tag ...
-
bioRxiv - Cell Biology 2022Quote: ... following the final wash proteins were eluted in Glycoprotein Denaturing Buffer (NEB, P0702S) for 10 mins at 100°C and then resuspended in EndoH (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: The furin cleavage specificity was assayed by incubating 2.5 μg (7.6 μM) S1/S2-GB1-6xHis substrate with 2 U furin (New England Biolabs, p8077) in 30 μl reactions ...
-
bioRxiv - Neuroscience 2022Quote: The three NMDAR fusion protein constructs were subcloned into pCSE2.7-mIgG2a-Fc-XP (N1-Fc and N2B-Fc) or pCSE2.8-mIgG2a-Fc-Xp (N1-N2B-Fc) using NcoI/NotI (New England Biolabs, Frankfurt, Germany) for mammalian production in Expi293F cells ...
-
bioRxiv - Biophysics 2022Quote: ... CLIP-tag (NEB), and HaloTag (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... all strains were generated by the S1/2/3/4 homologous recombination PCR integration method (Janke et al., 2004) using a Q5 PCR Kit (NEB). S1-S2 primers was used to knock out endogenous proteins ...
-
bioRxiv - Microbiology 2024Quote: ... The SV40 NLS was added to the C-terminus of CypA via annealing partially complimentary primers encoding the SV40 NLS (Table S1) at 20 μM with NEB buffer 2 (New England Biolabs) at 95° C for 4 min and 70° C for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... Precipitated proteins were resuspended in 150 μL of Glycoprotein Denaturing Buffer (New England Biolabs) and incubated at 100 °C for 10 min ...
-
bioRxiv - Biochemistry 2022Quote: The standard N-glycoprotein bovine pancreatic ribonuclease B (RNase B, New England Biolabs, USA) was used as a substrate to measure NGLY1 activity ...
-
bioRxiv - Cancer Biology 2020Quote: ... The lysate was denatured in glycoprotein-denaturing buffer and digested with PNGase (NEB P0704S) to remove N-linked glycoproteins ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... was generated from pCG1-SARS-2-S (a kind gift from M. Hoffmann9 by PCR (Phusion polymerase (NEB)) using primer pairs ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Immunology 2021Quote: The DNA sequences of B.1.351 and B.1.617 SARS-CoV-2 spikes for the mRNA transcription and pseudovirus assay were synthesized as gBlocks (IDT) and cloned by Gibson Assembly (NEB) into pcDNA3.1 plasmids ...
-
bioRxiv - Cell Biology 2019Quote: ... SNAP-tag (P9310S, NEB), and β-tubulin (abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP tag (NEB, P9310S) or GFP (MPI-CBG ...
-
bioRxiv - Biophysics 2020Quote: SNAP-tag ligands (NEB): SNAP-Cell TMR-star ...
-
bioRxiv - Microbiology 2020Quote: ... MBP-tagged RBD was affinity purified by Amylose Resin (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... was ordered and cloned into the pCG1-SARS-2BA.2 vector via Gibson assembly according to the manufacturer’s instructions (New England Biolabs). To this end the pCG1-SARS-2-BA.2 vector was amplified by PCR using appropriate primers (GTGCCATTGGTGCCGGACACG and CACCAGCCTTACAGAGTGG ...
-
bioRxiv - Cell Biology 2020Quote: ... Glycoprotein denaturation of the cell lysate was performed with 1x glycodenaturing buffer (New England Biolabs) at 95°C for 10 mins ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... using the primers in (Table S1) by HiFi (NEB) cloning ...
-
bioRxiv - Immunology 2022Quote: Single mutations of the spike protein were generated via two PCR fragments of the spike ORF using high-fidelity Phusion polymerase (New England Biolabs, USA). The first fragment was generated via a generic forward primer (pCAGGS-5 ...
-
bioRxiv - Microbiology 2021Quote: ... The SARS-CoV-2 S R403T and RaTG13 S T403R/T403A mutant plasmids were generated using Q5 Site-Directed Mutagenesis Kit (NEB).
-
bioRxiv - Biochemistry 2021Quote: Native glycoproteins (10 μg) were digested with 1 U of IMPa (O-Glycoprotease, New England Biolabs) in 50 μL 20 mM Tris-HCl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 2 mM CaCl2 and the TRX-6His-S-tag was cleaved overnight at RT with enterokinase protease (NEB). The ET domain was further purified using Nickel-NTA resin (Thermo Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... The SNAP-tag sequence (NEB) was cloned into a β-cell-specific expression vector with a porcine INS gene promoter ...
-
bioRxiv - Synthetic Biology 2022Quote: ... rabbit anti-SNAP-tag (NEB; P9310 ...
-
bioRxiv - Immunology 2022Quote: ... Delta and BA.2 spike plasmids were linearized by restriction enzymes and transcribed to mRNA by in vitro T7 RNA polymerase (NEB, Cat # E2060S) as previously described10.
-
bioRxiv - Cell Biology 2021Quote: ... m6A-modified RNA spike-in controls (New England Biolabs) and a nontargeted region on the crRNA-targeted transcript ...
-
bioRxiv - Microbiology 2021Quote: ... Yields of viral RNA were quantified by real-time qPCR by using SARS-CoV-2 specific primers targeting the E gene with the Luna®Universal One-Step RT-qPCR Kit (New England Biolabs) in a LightCycler 480 thermocycler (Roche ...
-
bioRxiv - Cell Biology 2022Quote: Lysates (20 μg) and media immunoprecipitates were diluted to 10 μL in 2X glycoprotein denaturing buffer (NEB), and boiled for 10 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... N-linked glycans released from glycoproteins using Peptide:N-glycosidase F (PNGase F, New England Biolabs, Ipswich, MA) were mixed with 2,5-dihydroxybenzoic acid (DHB ...
-
bioRxiv - Biophysics 2019Quote: ... SNAP-tag (New England Biolabs Inc.), FLAG-tag and 6 × His-tag were attached at the C-terminal ...
-
bioRxiv - Biophysics 2021Quote: ... SNAP-tag (New England Biolabs Inc.), FLAG-tag and 6 × His-tag were attached at the C-terminal via linkers (3 a.a. ...
-
bioRxiv - Cell Biology 2023Quote: ... SNAP-tag (New England BioLabs, N9181S), HaloTag (Promega ...
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... and spike-in lambda DNA (1.25 ng) (New England Biolabs) was sheared using the M220 ultrasound sonicator (Covaris ...
-
bioRxiv - Microbiology 2022Quote: ... 1-20 μg of the Env protein was mixed with 1 μl of Glycoprotein Denaturing Buffer (NEB, 10×) and H2O (if necessary ...
-
bioRxiv - Microbiology 2023Quote: ... The glycoprotein gene fragments and pCAGGS/MCS DNAs were ligated with Instant Sticky-End Ligase (New England Biolabs) and transformed into competent E ...
-
bioRxiv - Cell Biology 2023Quote: Equal amounts (25 μg) of whole normal muscle extracts were incubated with 1 x Glycoprotein denaturing buffer (Biolabs) at 100 °C for 10 min to denature glycoproteins ...
-
bioRxiv - Genomics 2023Quote: ... The DNA length and RNA absence were assessed by 2% agarose gel electrophoresis (50 V, 90 min) including the Quick-Load 1 kb DNA Ladder (New England Biolabs Inc., Ipswich, USA; Text S1). The extracted gDNA was not fragmented and larger than 10 kb (Fig ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the insertion of a DNA fragment containing C-terminal 2×HA tag by NEBuilder HiFi DNA Assembly Master Mix (NEB). Finally ...
-
bioRxiv - Biochemistry 2021Quote: pMAL-c4E vectors carrying in-frame fusions of the EFR cytoplasmic domain with the N-terminal maltose-binding protein (MBP) tag were transformed into Rosetta 2 cells (NEB) for recombinant protein expression ...