Labshake search
Citations for New England Biolabs :
151 - 200 of 3214 citations for S + α 1 Naphthyl ethylamine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... At least 50 μg of total RNA was randomly fragmented for 125 s at 90°C to approximately 200 nt using the NEBNext Magnesium RNA Fragmentation Module (New England Biolabs). Fragmented RNA was precipitated with 4 μl of GlycoBlue (Thermo Fisher) ...
-
bioRxiv - Microbiology 2023Quote: ... concisus for 2 h at 37°C in presence of 0.4 mM S-Adenosylmethionine (SAM, New England Biolabs, Ipswich, MA). After methylation ...
-
bioRxiv - Biochemistry 2023Quote: ... The same construct containing a blasticidin-S deaminase (BSD) gene in place of PAC was generated by Gibson assembly (NEB) using primers ZJ1-ZJ4 (Table S2) ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR fragment was gel purified and inserted into plasmids pTRC99a and pKI_IS10 (gift of S. Wenk) using HiFi DNA Assembly Cloning Kit (NEB. pZE21) for Gibson cloning ...
-
bioRxiv - Microbiology 2020Quote: ... The LPMO and CBH1 amplicons for detection were radio-labelled with [α-32P] dCTP using the NEBlot Kit (NEB, USA) according to the manufacturer’s instructions and used as a probe to determine the copy number of T-DNA integrations in all the transformants.
-
α-catenin links integrin adhesions to F-actin to regulate ECM mechanosensing and rigidity-dependencebioRxiv - Cell Biology 2021Quote: ... V796A mutations were inserted into the GFP-α-catenin plasmid using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs).
-
bioRxiv - Biochemistry 2022Quote: ... coli cells (α-select, XL1-Blue, or BL21-DE3 cells were used, depending on application; all originally sourced from NEB and obtained from lab made stocks ...
-
bioRxiv - Cell Biology 2022Quote: ... coli cells (α-select, XL1-Blue, or BL21-DE3 cells were used, depending on application; all originally sourced from NEB) for 30 min on ice ...
-
bioRxiv - Biochemistry 2023Quote: ... The oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Genetics 2020Quote: ... During the experiment a fresh aliquot with 46 ng/μl sgRNA and 3.13 μM commercial Cas9 enzyme (Cas9 Nuclease, S. pyogenes, 20 μM; NEB, Ipswich, USA) was used for each day and stored on ice.
-
bioRxiv - Systems Biology 2021Quote: ... Sequencing libraries were generated from the qualified DNA samples(s) using the NEB Next Ultra DNA Library Prep Kit for Illumina (NEB, USA) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) for the presence of the correct mutation(s) and the cassette for integration digested out with AscI (NEB, Hitchin, UK) prior to transfection.
-
bioRxiv - Molecular Biology 2021Quote: ... The G1 and S/G2 population were sorted using FACSAria II cell sorter (Becton Dickinson) in PBS supplemented with RNase inhibitor (NEB, M0314L). Sorted samples were processed for scRNA-seq or cDNA-seq.
-
bioRxiv - Genomics 2023Quote: Nuclei were resuspended in 200 uL of Methylation Reaction Buffer (Buffer M containing 1mM S-adenosylmethionine (SAM)) (New England BioLabs B9003S). 10uL high-concentration EcoGII was added per 1e6 nuclei and the nuclei suspension was incubated at 37°C for 30 minutes ...
-
bioRxiv - Genomics 2024Quote: ... The genomic DNA was incubated in a mix containing S-Adenosyl methionine (SAM) along with the DNA adenine Methyltransferase (dam, NEB, USA) and its corresponding buffer for 4 hours at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... were designed to have an additional 5’GG overhang on each end after annealing and were labelled by filling in with the large Klenow fragment of DNA Polymerase I in the presence of [α-32P]-dCTP as described by the manufacturer (New England Biolabs). For gel shift reactions ...
-
bioRxiv - Microbiology 2019Quote: ... and 1 ml of lysate (corresponding to 50 ml of the original culture) was transferred into tubes containing 50 μl of pre-washed (3x) magnetic α-HA beads (NEB) and incubated for 2 h at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Genomics 2019Quote: ... Approximately 20 ng of each DNA sample was digested with the restriction enzyme EcoRI (New England Biolabs, Ipswich, MA, U. S. A.) at 37°C for 2 hours and quality was evaluated on 1%agarose by gel electrophoresis ...
-
bioRxiv - Biochemistry 2019Quote: ... A 3’ DNA adapter (CTATAGTGTCACCTAAATTAATACGACTCACTATAGGG) that contains 5’ phosphate and 3’ spacers was first 5’-adenylated using a 5’-adenylation kit (NEB #E2610-S) at 65°C for 1 h ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid encoding for Spike G614 variant was generated using the pTwist EF1alpha nCoV-2019 S 2xStrep plasmid and the Q5 site-directed mutagenesis kit (New England BioLabs, Evry, France) following the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... with Poly(A) mRNA Magnetic Isolation Module (CAT#E7490S) and index PCR primers (CAT #s E7335, E7500) (New England Biolabs; Ipswich MA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... according to the manufacturer’s protocols and genomic libraries were prepared for Illumina sequencing using the NEBNext Ultra II DNA Library preparation kit (NEB #E7645, E7103) as described in the manufacturer’s protocols ...
-
bioRxiv - Plant Biology 2023Quote: ... PolyA mRNA was enriched using the protocol of NEBNext ® Poly(A) mRNA Magnetic Isolation Module (New England Biolabs #7490 S, USA). RNA sequencing libraries were then prepared using Hieff NGS® Ultima Dual-mode mRNA Library Prep Kit (Yeasen ...
-
bioRxiv - Plant Biology 2021Quote: ... behind the α-factor signal peptide sequence using SmaI/EcoRI restriction enzymes and T4 DNA ligase (New England Biolabs, Beverly, MA, USA). Here ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 S-FL K-to-R and SARS-CoV-2 S-Truncated K-to-R) were generated using the Q5® site-directed mutagenesis kit (New England BioLabs Inc., #E0552S) or the QuickChangeSite-Directed Mutagenesis kit (Stratagene ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were prepared in the Duke Center for Genomic and Computational Biology’s Sequencing and Genomic Technologies Core Facility using the NEBNext Single Cell/Low Input cDNA Synthesis and Amplification Module (NEB, catalog no. E6421) and SMRTbell Express Template Prep Kit 2.0 (Pacific Biosciences ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two DNA sequencing libraries were prepared from two wAlbB S mosquitoes using the NEBNext® Ultra™ II FS DNA Library Prep Kit for Illumina (New England Biolabs, E7805L) and NEBNext® Multiplex Oligos for Illumina® (New England Biolabs ...
-
bioRxiv - Genomics 2022Quote: ... 1 μl of Exonuclease 1 (NEB, M0293S) was added to each PCR product and incubated at 37C for 15 min to digest any single-stranded product ...
-
bioRxiv - Molecular Biology 2024Quote: ... in 1× NEB buffer 1 (NEB, B7001S) for 15 min at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... 1% cholorophorm was added together with 10 μg mL-1 DNase 1 (NEB) and 1 μg mL-1 RNase A ...
-
bioRxiv - Microbiology 2022Quote: The recombinant constructs (pETDuet-1-TaPHB-1 and pETDuet-1-TaPHB-1-RUVBL1 were separately transformed into E. coli Lemo21(DE3) (NEB) chemical competent cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... Unincorporated ddRTP molecules were inactivated by adding 1 µL of Buffer 2 (80 mM MgCl2) and 1 µL of 1:1 rSAP (NEB):50% glycerol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM MgCl2) supplemented with 1 mM ATP and 1 U/μL RNase Inhibitor (NEB). Reaction was incubated for 1 hour at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 unit µL-1 EcoRI-HF (New England Biolabs)) ...
-
bioRxiv - Biophysics 2020Quote: ... 1 U μL−1 murine RNase inhibitor (NEB, M0314L), 600 ng mRNA and 50 μM PF846 in 1% DMSO ...
-
bioRxiv - Genomics 2021Quote: ... 1 unit/μl RNA ligase 1 (New England Biolabs), 1× RNA ligase buffer ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 U.μL-1 of murine RNase Inhibitor (NEB M0314), 500 μM of rNTPs (NEB ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl 40 U/μl−1 RNase Inhibitor (NEB), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1 μl T4 DNA Polymerase (1 U, NEB). Gap-filling reactions purified using the Zymo Research kit and eluted with 6 uL water ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with 1 U μl−1 RNase inhibitor (NEB), or bulk sorted into buffer RLT Plus (Qiagen ...
-
bioRxiv - Microbiology 2024Quote: ... and used in a 1:1:1 molar ratio Golden Gate assembly reaction with BsaI (NEB) and T4 ligase (NEB ...
-
bioRxiv - Microbiology 2022Quote: ... 1 μl 40 U μl-1 RNase Inhibitor (NEB, M0314), and 1 μl T4 RNA ligase 2 (truncated K227Q ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 ul T4 RNA ligase 1 (10U/ul – NEB M0204), 0.5 ul 100 uM 5’ RNA linker (Blocked at 5’ end & contains NNNN at 3’ end for barcoding) ...
-
bioRxiv - Biochemistry 2020Quote: ... 1 U/μL T4 RNA ligase 1 (New England Biolabs), 1.3 U/μL Ribolock RNase inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Genomics 2021Quote: ... 1 ul i7 and 1 ul i5 (from NEB #E7600S), 8 ul 1st PCR product after SPRI beads ...
-
bioRxiv - Cell Biology 2022Quote: ... 1:100 or 1:1000 (stock 10 mg/mL, NEB) or with 1:10 Dnase I (stock 2 U/μL ...