Labshake search
Citations for New England Biolabs :
1 - 50 of 2304 citations for Rnase 3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) in RNase H buffer (NEB, M0297) overnight at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 3 µl Hind III (Fisher, FD0504), 3 µl EcoRI (Fisher, FD0274), and 3 µl Bam HI (Fisher, FD0054) +/-5 µl RNase H (NEB, M0297) in RNase H buffer (NEB ...
-
bioRxiv - Microbiology 2024Quote: ... and 3 µL RNase A (NEB) in volumes normalized to OD600 of culture samples ...
-
bioRxiv - Microbiology 2021Quote: ... 40 U RNase Inhibitor Human Placenta (NEB), 50 pmol Oligo d(T)23 (NEB ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 µL murine RNase Inhibitors (40 U/µL NEB) and 125 µM NTP-mix (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μl (0.5 μl per sample volume) of RNase If (NEB) was added and the sample was incubated at 37 °C for 15 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3 mM MgCl2 and 2 μL (10 u) RNase H (NEB) in order to digest poly(A ...
-
bioRxiv - Molecular Biology 2023Quote: Hi-C libraries were treated with 3 U of T4 DNA polymerase (NEB) in the presence of 0.1 mM dGTP (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... purified RNA was dissolved in 3 μl RNase H reaction mix (1x RNase H buffer [NEB], 40 pmol oligo(dT)12 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 mM MgCl2 and 2 μL (10 U) RNase H (NEB, Cat# M0297S) in order to digest poly(A ...
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
ADAR2 deaminase activity promotes Th17 effector function and protects against intestine inflammationbioRxiv - Immunology 2022Quote: ... RT-PCR was performed on cDNAs from murine Th17 or human HEK293 cells using the Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) with the standard thermocycling protocol ...
-
bioRxiv - Molecular Biology 2022Quote: The HRAS minigene reporter was constructed by PCR amplifying a ∼900bp region spanning exon 4 to exon 6 from human genomic DNA isolated from HEK293 cells using Phusion high- fidelity DNA polymerase (NEB). The PCR fragment were inserted into pcDNA3.1(+ ...
-
bioRxiv - Genomics 2021Quote: ... 1 μl of RNAse inhibitor and 3 μl of Antarctic phosphatase (New England BioLabs Inc.). We then performed a kinase treatment adding 4 μl of T4 Polynucleotide Kinase (PNK ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA 36 using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (Table S1) ...
-
bioRxiv - Microbiology 2023Quote: ... All 3 fragments were amplified from pTRL2-His-GrgA (28) using Q5 DNA polymerase (New England Biolabs). Fragment 1 was generated using primers pgp3-pgp4-F and His-RBS-R (sTable 5) ...
-
bioRxiv - Neuroscience 2023Quote: Codon-optimized human TDP-43-His LIC-A constructs were transformed into T7 express (New England Biolabs, #C3029J) E ...
-
bioRxiv - Cell Biology 2021Quote: ... Par-3 PDZ1-APM and PDZ1-APMΔPDZ2 were first his-purified (described above) prior to incubation with amylose resin (NEB). Amylose-bound Par-3 was then washed and resuspended in binding buffer as described for GST proteins.
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of RNase inhibitor and 3 μl of T4 RNA ligase 2 (truncated) (New England Biolabs) were added and mix well by pipetting ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 uL RNase A and 1 uL ProtK all from the Monarch gDNA extraction kit (NEB, T3010). gDNA was extracted following the extraction kit’s protocol with the exception that 600 uL of gDNA binding buffer were added to 400 uL quenched reaction and added to the extraction column on two spins of 2 minutes at 1000g ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNase III (ShortCut RNase III, M0245S, New England Biolabs), and/or human RNase H1 [37] and incubated with rocking for 1 hour ...
-
bioRxiv - Biochemistry 2022Quote: ... thermophilus RNase H (Thermostable RNase H, New England Biolabs) at a final concentration of 5 U/μL at 37°C for 1 h ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Microbiology 2020Quote: ... RNase H (NEB), in a total volume of 80µL ...
-
bioRxiv - Biochemistry 2021Quote: ... RNase inhibitor (NEB) and 20 ug of competitor yeast tRNA (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... RNase H (NEB) and dUTP Solution (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2019Quote: ... RNase inhibitors (NEB) were used during the preparation of RNA-containing substrates and during helicase assays with RNA/DNA hybrid fork substrates ...
-
bioRxiv - Genetics 2021Quote: ... RNase H (NEB) and a dUTP solution (Thermo Fisher) ...
-
bioRxiv - Biochemistry 2021Quote: ... RNase inhibitor (NEB) and 1% BSA ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Biophysics 2023Quote: ... RNAse H (NEB)) ...
-
bioRxiv - Microbiology 2023Quote: ... RNAse H (NEB) was added to remove RNA and samples were incubated at 37°C for 20 min ...
-
bioRxiv - Bioengineering 2023Quote: ... RNase I (NEB) and DNase I (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... the tbb-2 3’UTR sequence was amplified from genomic DNA using PCR and primers 5’-tggatgaactatacaaatagatgcaagatcctttcaagca-3’ and 3’-aggttttcaccgtcatcacccgcgaaaaacccatgtaagt-5’ and the vector containing the sequence of pie-1p::his-15::gfp amplified from plasmid containing pie-1p::his-15::gfp::egg-6 3’UTR using PCR and primers 5’-ggtgatgacggtgaaaacct-3’ and 3’-ctatttgtatagttcatccatgcc-5’ were used to generate pie-1p::his-15::gfp::tbb-2 3’UTR by using Gibson assembly (NEB E2611). To add the wild type or mutant 3xmir-51 seed sequences ...
-
bioRxiv - Biochemistry 2021Quote: ... per 1g of wet cell weight and 1 Unit of 30 Units/μL RNase Inhibitor (from human placenta; New England Biolabs (NEB), No ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1X Protoscript II buffer (50 mM Tris-HCl pH 8.3, 75 mM KCl, 3 mM MgCl2) 40 U Murine RNase Inhibitor (NEB), 5 mM DTT and pre-incubated for 10 minutes at 42 °C ...
-
bioRxiv - Molecular Biology 2019Quote: ... RNase digestion was stopped with 11 µl Murine RNase inhibitor (NEB) and insoluble material removed by centrifugation (15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... or RNase A (2 µg, Monarch RNase A; New England Biolabs) and incubating for another 15 min at 25°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Biochemistry 2021Quote: ... per 1g of wet cell weight and 1 Unit of 30 Units/μL RNase Inhibitor (from human placenta; New England Biolabs (NEB), No ...
-
bioRxiv - Biophysics 2019Quote: ... were bound to the beads in the presence of 1 µM DNA oligonucleotide 5’-TCTCCTCCGAAGAAA-3’ (targeting DNA) and 2 µL RNase H (5 units/µL, NEB) were added to the reaction ...
-
bioRxiv - Microbiology 2020Quote: ... 3-5 μg of RNAse H treated RNA was circularized using T4 RNA ligase 1 (ssRNA Ligase, New England Biolabs), RNA was extracted with phenol/chloroform approach and ethanol precipitated ...
-
bioRxiv - Physiology 2021Quote: ... samples were resuspended in RNAse-free water and ligated to a 5’-adenylated DNA adaptor (5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC/-3′ (M0373, New England Biolabs), for 3 hours at room temperature ...
-
bioRxiv - Molecular Biology 2022Quote: ... 3 nM RNAse-free DNA fragments containing gRNA target sequences and 30 nM Cas9 or Cas12a protein (NEB, Ipswich, MA) were mixed in reaction tubes as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was treated with RNase H before second-strand synthesis by Klenow fragment (3′ to 5′ exonuclease) (New England Biolabs), then the double-stranded cDNA was sheared into average of 200 bps fragments using a Covaris focused ultrasonicator E210 ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were subjected to RNase H (15U/well) or RNase H (NEB) buffer only treatment for 4 hr and RNase III or RNase III buffer (Ambion ...
-
bioRxiv - Biochemistry 2022Quote: ... cerevisiae tRNA standard was purchased from Thermo Fisher and digested with both RNase T1 and RNase A (#T3018) from NEB biosciences for 45 minutes at room temperature in triplicate ...
-
bioRxiv - Genomics 2019Quote: ... or 5μL NEB RNase H reaction mix (10U NEB RNase H [NEB M0297S] and 1uL 10X NEB RNase H reaction buffer ...
-
bioRxiv - Molecular Biology 2022Quote: ... Murine RNAse Inhibitor (NEB), Complete Protease Inhibitor (Pierce ...