Labshake search
Citations for New England Biolabs :
251 - 300 of 10000+ citations for Retinol Binding Protein RBP Multi format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Microbiology 2020Quote: ... with a 384 well plate using the NEB Luna Universal One-Step RT-qPCR kit (NEB #E3005L, New England Biolabs Inc) and a reaction volume of 10 μl with 2.5 μl of sample ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5′-cap was removed with RNA 5’ Pyrophosphohydrolase (Rpph, NEB), and the 5′-hydroxyl group was repaired with T4 polynucleotide kinase (BioLabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µ l of Klenow Fragment (3’→5’ exo-, NEB, M0212S) 3µl of T4 Polynucleotide Kinase (NEB ...
-
bioRxiv - Genomics 2020Quote: RNA 5’ pyrophosphohydrolase (RppH; 5 U/µL) (NEB, cat. no. M0356S)
-
bioRxiv - Molecular Biology 2021Quote: ... the 5’-cap was removed with RNA 5’ pyrophosphohydrolase (Rpph, NEB), after which 5’end was repaired with T4 polynucleotide kinase (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of 5mM dNTPs containing 5-methyl-dCTP (N0356S, NEB) instead of dCTP ...
-
bioRxiv - Genomics 2023Quote: ... 5 μL of Digestion-2 mix (NdeI (5 U, NEB, R0111L) and/or BglII (5 U ...
-
bioRxiv - Bioengineering 2022Quote: ... the 5S and Saba PCR products were purified using Monarch® PCR & DNA Cleanup Kit (5 μg) (NEB, # T1030). The purified DNA sequence was then analyzed through Sanger sequencing (GENEWIZ from Azenta ...
-
bioRxiv - Plant Biology 2023Quote: The m6A immunoprecipitation was performed from 5–day–old seedlings using the EpiMark® N6–Methyladenosine Enrichment kit (NEB) starting from 4 μg of total RNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... was generated from full-length CSN-5 using a Q5 site-directed mutagenesis kit per manufacturer’s instructions (New England BioLabs). Truncated CSN-5 constructs were made by PCR from full-length CSN-5 and inserted into pGEX-KG plasmids ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 pmol of TP_MAAAPQKCAAA* mRNA (see “Toeprinting assays” section) and components of the PURExpress ΔRibosomes Kit (New England Biolabs). The reaction was incubated at 37ºC for 20 min and then diluted in 50 mM Hepes KOH pH 7.5 ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA samples (5-500 ng) were hybridized with NEBNext rRNA Depletion Kit v2 (Cat# E7400; New England Biolabs) to diminish rRNA from the samples ...
-
bioRxiv - Microbiology 2019Quote: ... samples were enriched for mRNA using oligo-dT binding and magnetic separation using the NEBNext Poly(A) Magnetic Isolation Module (New England Biolabs). Samples were reverse transcribed using the NEBNext RNA First and Second Strand Synthesis Modules (New England Biolabs ...
-
bioRxiv - Genomics 2019Quote: ... Ligated RNA was enriched with biotin-labeled products by another round of Streptavidin bead binding and washing (two washes each of High, Binding and Low salt buffers and one wash of 1x Thermo Pol Buffer (NEB)) ...
-
bioRxiv - Biochemistry 2020Quote: Expressed proteins were purified using the intein-mediated purification and affinity chitin-binding tag (IMPACT) chitin affinity matrix system (New England Biolabs). A cell pellet was dissolved in 8 mL of column buffer (20 mM Tris-HCl ...
-
bioRxiv - Microbiology 2022Quote: ... and a 609bp sequence with the ydgA pseudogene (common binding site for reverse primer) were synthesized (gBlocks, Integrated DNA Technologies) and cloned by Gibson Assembly Master Mix (NEB) into an NBU2 plasmid carrying the erythromycin resistant cassette ermG (tagged B.theta-EryR strains) ...
-
bioRxiv - Genetics 2019Quote: ... This was subsequently added to 10x volume of modified binding buffer (Allentoft et al. 2015) and passed through a Monarch silica spin column (NEB) by centrifugation (Supplementary Methods Section 1 and Supplementary fig ...
-
bioRxiv - Biochemistry 2021Quote: ... using a plasmid that codes for the desired protein sequence fused to an N-terminal intein and chitin binding domain (CBD) as part of the IMPACT purification system (NEB). 2 liters of cells were grown to an OD600 of 0.6 and induced with 1 mM IPTG for 3 hours at 25 °C ...
-
bioRxiv - Immunology 2021Quote: ... and used as template to test for binding of the PMCA4b promoter region using Q5 hot start polymerase (NEB biolabs) and the primers ...
-
bioRxiv - Molecular Biology 2021Quote: ... Non-binding double mutant R1226L/W1289A and non-binding single mutant W1289A were generated by Q5 site-directed mutagenesis (New England Biolabs). Constructs were sequence verified.
-
bioRxiv - Bioengineering 2022Quote: ... PCR product with consensus ribosome binding site (RBS) AAGGAG introduced upstream the gene was purified and digested with PstI and HindIII (New England Biolabs). Digested fragment was ligated into pSEVA2213_bglC plasmid cut with the same restriction endonucleases ...
-
bioRxiv - Developmental Biology 2022Quote: ... The chitin-binding probe (CBP546) was prepared from a bacterial expression construct using the protocol provided by Yinhua Zhang (New England Biolabs) (Dong et al. ...
-
bioRxiv - Biophysics 2022Quote: ... 6 BindingPCA plasmids are constructed by ligating each binding partners PCR product which was digested by BamHI and SpeI to digested pGJJ317 using T4 Ligase (NEB). To construct RAF1 bindingPCA plasmid (pGJJ336) ...
-
bioRxiv - Cell Biology 2023Quote: ... The mixtures were diluted into 400 µl of Binding Buffer and then incubated with the appropriate resin (amylose for MBP, New England Biolabs # E8021S ...
-
bioRxiv - Microbiology 2023Quote: ... and eukaryotic mRNA was removed by binding and discarding the eukaryotic mRNA polyA region to oligo d(T)25 magnetic beads (England Biolabs). Finally ...
-
bioRxiv - Biochemistry 2023Quote: ... following the manufacturer’s protocol and adapting the IMPACT (Intein Mediated Purification with an Affinity Chitin-binding Tag) System (NEB # 6901S). The human eIF2A coding sequence was cloned into the C-terminal Mxe GyrA Intein-chitin-binding domains (CBD ...
-
bioRxiv - Cancer Biology 2022Quote: Codon-optimized sequences encoding the DNA-binding domains of human BATF (AA 28-87) and JUNB (AA 269-329) were cloned into pMAL-C2X (NEB). The sequence encoding human IRF4 DBD (AA 19-120 ...
-
Sphingosine induction of the Pseudomonas aeruginosa hemolytic phospholipase C/sphingomyelinase, PlcHbioRxiv - Microbiology 2023Quote: The allelic exchange vector for mutation of the SphR binding site in the cerN promoter was built using HiFi assembly (NEB) from two PCR products amplified from PA14 genomic DNA and HindIII and KpnI cut pMQ30 ...
-
bioRxiv - Genomics 2019Quote: 5’ repaired RNA was ligated to reverse 5’ RNA adaptor (5’-rCrCrUrUrGrGrCrArCrCrCrGrArGrArArUrUrCrCrA-3’) with T4 RNA ligase I (NEB) under manufacturer’s conditions for 2 h at 20°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1600 v/10 ms /3 pulses for 200,000 cells in Buffer R (Neon Transfection kit) premixed with 50 pmol Cas9 protein (CAT#M0646T, New England Biolabs), 50 pmol single guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Physiology 2021Quote: ... The biotinylated peptides were placed on streptavidin-coated plates and three rounds of solid-phase panning were conducted using 109 random 12-mer peptides fused to a minor coat protein of M13 (pIII) following the manufacture’s protocol (Ph.D-12 Phage Display Peptide Library Kit, NEB, E8110S). Sequenced data were subsequently analyzed as follows ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... see Supplementary Data 6) and cloned into pDHFR vector provided in the PURExpress In Vitro Protein Synthesis Kit (NEB). The translation into liposomes was done as described previously95 and the output was analyzed by Blue Native PAGE using 2% digitonin and NativePAGE Novex 4-16% Bis-Tris Protein Gel (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... 20 ng of each integrase amplicon was used per reaction using PURExpress® In Vitro Protein Synthesis Kit (NEB) in a total volume of 9 µl ...
-
bioRxiv - Microbiology 2022Quote: ... Protein samples were then mixed with Blue Protein Loading Dye (NEB) boiled for 10 minutes and separated on 10% SDS-PAGE gel for 50 minutes at 140 V ...
-
bioRxiv - Plant Biology 2021Quote: ... and extracted nuclear proteins were treated with lambda protein phosphatase (NEB) according to the manufacturer’s instruction.
-
bioRxiv - Genomics 2020Quote: ... Endogenous proteins were captured onto protein G-magnetic beads (NEB; #S1430S), washed extensively in IP buffer and used for POT1wtand POT1V29L source ...
-
bioRxiv - Molecular Biology 2022Quote: For chitin-based sandwich ELISA 50 μl of chitin magnetic beads (New England Biolabs, Ipswich, MA, USA) were transferred into a 1.5 ml reaction tube ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 μL of 2 mg mL-1 Y289L GalT,46 50 μL of 500 kU mL-1 PNGase F (New England Biolabs, 5 U μg-1 of protein), and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 µg of total RNA was incubated with 5 μM oligo-(dT)-anchor (5’GCGAGCTCCGCGGCCGCGTTTTTTTTTTTT3’) and 5 U of Klenow polymerase (New England Biolabs) for 1 h at 37°C for template extension of the poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... the purified DNAs were annealed using random nonamer primers with a 5′-biotin tag (5′-Biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3′) in the presence of Klenow fragments (3′-5′ exo-, New England Biolabs). Then ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Cancer Biology 2022Quote: ... 5 µg DNA was digested with 5 µl RNase H (NEB, M0297), 3 µl Hind III (Fisher ...
-
bioRxiv - Molecular Biology 2021Quote: ... m7G(5’)ppp(5’) A RNA Cap Structure Analog (New England Biolabs) was included in the transcription reaction ...
-
bioRxiv - Microbiology 2021Quote: ... T5 exonuclease diluted 1:5 with 5× reaction buffer (New England BioLabs) (0.01 units/μl) ...
-
bioRxiv - Genomics 2021Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Genomics 2022Quote: ... (iii) 5′ de-capping with RNA 5′ pyrophosphohydrolase (NEB, Ipswich, MA; M0356), (iv ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µg of DNA were nicked with 5 units of Nb.BbvCI (NEB) in CutSmart buffer (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... Full-length 265 nt 5’ UTR of SARS-CoV-2 was subcloned to replace the 5’ UTR of human CMV in the pLV-mScarlet vector using a Hifi one-step kit (Gibson Assembly, NEB). Full-length ...