Labshake search
Citations for New England Biolabs :
1 - 50 of 544 citations for Recombinant Mouse F3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: Ni pull down experiments were performed using 3μl of His tagged OsSRT1 constructs (0.3μg/ul) and 1μg recombinant human Histone H3 (NEB) and mixed with 20 μl of Ni-NTA slurry (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 μg/well of purified BSA (NEB) in a volume of 50 μl ...
-
bioRxiv - Cancer Biology 2019Quote: ... were coated to dry overnight at 37°C with 400 ng/well of recombinant His-tagged GT198 proteins together with 5 µg/well of purified BSA (NEB) in a volume of 50 µl ...
-
bioRxiv - Immunology 2024Quote: ... meningosepticum) and Endo F3 (NEB) (designated as F1 ...
-
bioRxiv - Microbiology 2024Quote: ... His- tagged proteins were purified by NEBExpress® Ni-NTA Magnetic Beads (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: C-terminally (His)6-tagged LukE was expressed in BL21 (DE3) Escherichia coli cells (NEB). Transformed cells were grown at 37 °C in Terrific broth supplemented with 100 μg/mL ampicillin to a density of OD600 = 0.6 ...
-
bioRxiv - Biochemistry 2022Quote: Cysteine mutations were introduced into a pENTR1A FLAG (FT) WT F3 or pENTR1A 3xFT WT F3 plasmid using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs, Ipswich, MA, USA). pENTR1A constructs were shuttled into the pcDNA DEST40 vector (Life Technologies ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Biochemistry 2021Quote: ... His tagged proteins were eluted with lysis buffer containing 400mM imidazole and bound immediately to amylose resin (NEB) for 1hr ...
-
bioRxiv - Cell Biology 2023Quote: ... sequences of all myc-his tagged RBPs were digested using ClaI and PmeI restrictions enzymes (New England Biolabs), blunted using DNA polymerase I large Klenow fragment (New England Biolabs ...
-
bioRxiv - Plant Biology 2023Quote: ... and recombinant MBP-tagged proteins purification were performed according to the manufacturer’s instructions of Amylose Resin (NEB).
-
bioRxiv - Biophysics 2021Quote: Wild-type MukB was 6×His-tagged at the C-terminus and was expressed from plasmid Pet21 in C3013I cells (NEB). For Immobilized His6-tagged MukB ...
-
bioRxiv - Microbiology 2021Quote: ... and cloned to the C terminus of a 11 His-tagged maltose-binding protein in a pMAL-C5X vector (New England Biolabs) separated by a cleavage site for tobacco etch virus protease ...
-
bioRxiv - Biochemistry 2023Quote: Purified CBC or CBC-ARS2147-871 and their mixtures with different His-MBP-tagged partners were loaded onto Amylose resin columns (NEB). Columns were then extensively washed with a buffer containing 100 mM Tris pH 8 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant C-terminally FLAG-Tagged TEX264 was produced by PURExpress in vitro protein synthesis kit (E6800; New England Biolabs). Phosphorylation reaction containing TEX264-FLAG and CK2 (mixture of CK2A1 and CK2B ...
-
bioRxiv - Molecular Biology 2021Quote: ... EcoRI sites underlined) and different concentration of recombinant His-SET8 protein (0 to 1.4 μM, New England Biolabs) were incubated for 10 min on ice in 1× GRB binding buffer [20 mM HEPES pH 7.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... was performed using 10ng of His tagged PTP-PEST (WT) plasmid as template and followed by Dpn1 (New England Biolabs, UK) digestion for 2 hours at 37°C ...
-
bioRxiv - Biophysics 2023Quote: ... 100 μg of each RBD was treated with endo F3 (purchased from New England Biolabs) in 1x Glycobuffer (50 mM sodium acetate ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the second fragment with aft cDNA F3 (TACCTTCATAGCAAATATGAAAAGGATGAGATTAAATGGCGCTGGCGCTCAACTACTTTG) and aft cDNA R1 (CTCGGTACCAAATACtGCTGCCGACTCTTGGATGGAACCGACATCTG) with Q5 polymerase (NEB), the two PCR fragments were then fused by PCR and cloned with EcoRI and KpnI into the pUC 3GLA vector 45 containing an attB site for phiC31 mediated integration ...
-
bioRxiv - Plant Biology 2023Quote: ... MBP-tagged and GST-tagged proteins were detected using anti-MBP (E8032S, NEB) and anti-GST antibody (60-021 ...
-
bioRxiv - Plant Biology 2020Quote: ... Bael-GFP-R2) and RHA (Bael-RHA-F3, Bael-RHA-R3) and cloned into pMOD_C0000 using Gibson Assembly® (New England BioLabs). Editing of the repair template by Cas9 was prevented by single base pair substitutions of the PAM sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... CMTr1 was amplified from this cDNA with primers pUAST CG6379HA F2 (CGAACCTTCGGACGATGAGAACTCGGAGCCCACGCCCAAGAAG) and pUAST CG6379 F3 (GCAGAATTCGAGATCTAAAGAGCCTGCTAAAGCAAAAAAGAAGTCACCATGGA CGAACCTTCGGACGATGAGAACTCG) with return primer R5 Spe in a nested PCR with Q5 polymerase (NEB) and cloned with EcoRI and SpeI into a modified pUAST vector containing an attB site for phiC31 mediated integration ...
-
bioRxiv - Molecular Biology 2021Quote: Biotinylation of SNAP tagged proteins and Avi-tagged proteins were performed as suggested by manufactures (NEB, Avidity). Direct biotinylation of proteins for example-YenB ...
-
bioRxiv - Microbiology 2022Quote: DNA from two samples (R-F1-E and S-F3-N) were used for preparing DNA metagenome libraries using NEBNext Ultra DNA Library Prep Kit (NEB, Ipswich, MA) following manufacturer’s instructions ...
-
A Bidirectional Switch in the Shank3 Phosphorylation State Biases Synapses toward Up or Down ScalingbioRxiv - Neuroscience 2021Quote: ... Constructs expressing GFP-tagged or HA-tagged Shank3 phospho-mutants were generated using the Gibson Assembly kit (NEB) with the wild-type Shank3 as the template ...
-
bioRxiv - Cell Biology 2021Quote: ... SNAP-tagged and Halo-tagged versions of TBK1 constructs were generated by inserting SNAP (pSNAPf [New England Biolabs]) or (Halo [pHaloTag vector ...
-
bioRxiv - Cancer Biology 2020Quote: ... with Hi-Fi DNA builder (NEB). Primers used to amplify specific regions are described in (Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Recombinant Cas9 protein (NEB) and sgRNA prepared by in vitro transcription were added to the mixture and incubated at 37℃ for ∼ 4h to remove rRNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Immunology 2023Quote: ... via recombinant neuraminidase (NEB P0720L) as described by the manufacturer ...
-
bioRxiv - Immunology 2021Quote: ... or Amylose resin (MBP-tagged fragments, New England Biolabs) following the manufacturer’s protocols.
-
bioRxiv - Biophysics 2022Quote: ... 2018) and a C-terminal 6x His tag and cloned into the pET21B vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The DNA fragment was amplified by PCR by inserting a C-terminal 6x His tag and cloned into the pETDUET-1 vector by Hi-Fi DNA assembly (NEB).
-
bioRxiv - Biochemistry 2021Quote: ... 25 U Hi-T7 RNA polymerase (NEB #M0658), 250 nM RNaseAlert™ QC System v2 (ThermoFisher ...
-
bioRxiv - Biochemistry 2022Quote: ... with recombinant proteins (200-500 ng) and yeast purified CK2 or recombinant human CK2 (NEB, P6010S). Proteins were resolved by SDS-PAGE and the gels were exposed to autoradiography or stained with Coomassie blue.
-
bioRxiv - Bioengineering 2022Quote: Recombinant Cas9 (New England Biolabs, USA) was used to generate a standard curve (20µM ...
-
bioRxiv - Physiology 2022Quote: ... Recombinant CK2 was purchased from NEB. Recombinant TGFBR1 was purchased from Proqinase ...
-
bioRxiv - Molecular Biology 2020Quote: ... MBP-tagged complexes were further purified on amylose resin (NEB). The core complex without MBP was instead further purified on Anti-Flag M2 affinity resin (Sigma) ...
-
bioRxiv - Microbiology 2020Quote: ... MBP-tagged RBD was affinity purified by Amylose Resin (NEB) according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... was cut with Hind III and Bam HI (NEB) for 1h at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... and His-MBP-ZFC3H1 onto an Amylose resin (NEB). After extensive washing ...
-
bioRxiv - Immunology 2021Quote: ... were assembled using Hi-Fi DNA Assembly Mix (NEB). For the SFFV-Cas9 vector ...
-
bioRxiv - Biochemistry 2021Quote: ... Nb35–His (10µg/ml) and apyrase (25mU/ml, NEB); the suspension was incubated for 1h at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... or Hi-Fi assembly from New England BioLabs (NEB) and other basic molecular cloning approaches ...
-
bioRxiv - Genomics 2021Quote: ... was then inserted by Hi-Fi assembly (NEB, E2621) using 0.025 pmols of vector and 0.05 pmols of the GFP amplicon ...
-
bioRxiv - Cell Biology 2021Quote: ... using NEB Hi-Fi assembly mix (New England Biolabs). A mixture of the two guide plasmids (each at 100ng/µl ...
-
bioRxiv - Developmental Biology 2023Quote: ... or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs) was used ...
-
bioRxiv - Biochemistry 2024Quote: ... We expressed the His-SUGCT in Lemo cells (NEB), inoculating 4L of TB with 4 mL overnight culture ...
-
bioRxiv - Molecular Biology 2021Quote: ... SET8 recombinant enzyme (New England Biolabs # M0428S) was incubated with recombinant active PARP1 (Trevigen # 4668-100-01 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3µl recombinant AsiSI endonuclease (10U/µL, NEB) was added to three biological replicates and incubated (2 h ...