Labshake search
Citations for New England Biolabs :
401 - 450 of 1590 citations for Recombinant Human Long Arg3 Insulin like Growth Factor I since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... and treated with Exonuclease I (New England Biolabs) to remove the single-stranded reverse transcription primers before PCR amplification.
-
bioRxiv - Microbiology 2021Quote: ... 30 units of DNase I (New England Biolabs), and 10 μl of concentrated protease inhibitor cocktail (Sigma ...
-
bioRxiv - Molecular Biology 2022Quote: ... total RNA was treated with DNase I (NEB) according to the manufacturer’s instruction and further purified using a Monarch® RNA Cleanup Kit (50 μg ...
-
bioRxiv - Genetics 2019Quote: ... and then digested using T4 Endonuclease I (NEB). Cut/uncut ratios were calculated following agarose gel electrophoresis and the most efficient sgRNA pairs were chosen for subsequent use ...
-
bioRxiv - Developmental Biology 2019Quote: ... plus 0.5 μL DNase I (New England Biolabs) for ∼45 minutes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each pool was treated with Exonuclease I (NEB) for 30 min at 37°C and cleaned by 1.2× volumes of SPRI beads (Beckman Coulter) ...
-
bioRxiv - Biophysics 2021Quote: ... here DNase I (NEB B0303S, Ipswich, MA USA), is delivered through the channels ...
-
bioRxiv - Molecular Biology 2020Quote: ... lysate was first treated with DNAse I (NEB) to mitigate genomic DNA viscosity when loading into SDS-PAGE gels ...
-
bioRxiv - Biochemistry 2019Quote: ... containing 1 U DNase I (New England Biolabs) at 37C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... except that 10 units of DNase I (NEB) was added to reactions 7 minutes after incubation with 500ng of transforming DNA ...
-
bioRxiv - Cell Biology 2019Quote: ... Samples were treated with DNase I (NEB M0303) and RNA isolated by ethanol precipitation ...
-
bioRxiv - Molecular Biology 2020Quote: ... and T7 endonuclease I (M0302S, New England Biolabs).
-
bioRxiv - Neuroscience 2021Quote: ... After treatment with Exonuclease I (New England Biolabs) to remove excess primers ...
-
bioRxiv - Systems Biology 2021Quote: ... the primers were digested by exonuclease I (NEB) and the DNA was purified using Agencourt Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Developmental Biology 2021Quote: ... which was co-injected with I-SceI (NEB) into the Tg(kdrl:CreERT2)cq24 embryos for transgenesis and screen ...
-
Glucocorticoid receptor collaborates with pioneer factors and AP-1 to execute genome-wide regulationbioRxiv - Genomics 2021Quote: ... was ligated with T4 RNA ligase I (NEB) for 12 hours at 20°C ...
-
bioRxiv - Genetics 2020Quote: ... 50 U of DNA polymerase I (NEB, M0209S) and 30 μM of each dGTP and dTTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2000U/mL DNase I (New England Biolabs, M0303S) and 1M MgCl2 were added to cell lysis at 1:100 (v/v ...
-
bioRxiv - Genetics 2022Quote: ... was linearized with Pme I (New England Biolabs) and purified by ethanol precipitation ...
-
bioRxiv - Microbiology 2022Quote: ... samples were first treated with DNase I (NEB) then heated to 75°C for 10 min to inactivate the DNase ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with 1X DNase I reaction buffer (NEB B0303S) in UltraPure DNase/RNase-Free distilled water at 37°C for one hour ...
-
bioRxiv - Molecular Biology 2022Quote: ... treated with DNase I (4U; New England Biolabs) in the presence of RNasin (2.5U ...
-
bioRxiv - Molecular Biology 2022Quote: ... extracted RNA was treated with DNase I (NEB) and Ribo-Zero rRNA removal kit (Illumina) ...
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New England Biolabs) before amplification using the Advantage 2 PCR kit (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: ... cDNAs were treated with Exonuclease I (NEB, M0293L) at 37°C for 1 hour ...
-
bioRxiv - Genetics 2023Quote: ... and degraded using Exonuclease I and III (NEB). The resulting ssDNA template was then split between 6 parallel reactions and custom mutagenic oligo primers (IDT ...
-
bioRxiv - Genomics 2023Quote: ... and 3 µl of Exonuclease I (NEB, #M0293L). The mixture was then incubated at 37°C for 1 hour at 900 r.p.m.
-
An adaptive biomolecular condensation response is conserved across environmentally divergent speciesbioRxiv - Cell Biology 2023Quote: ... Samples were treated with Dnase I (NEB M0303S). Two biological replicates were generated for each organism and condition ...
-
bioRxiv - Microbiology 2023Quote: ... treated with DNase I (New England Biolabs, NEB), end-repaired with T4 Polynucleotide Kinase (NEB) ...
-
bioRxiv - Microbiology 2023Quote: ... treated with DNase I (New England Biolabs, NEB), end-repaired with T4 Polynucleotide Kinase (NEB) ...
-
bioRxiv - Neuroscience 2023Quote: ... coli DNA polymerase I (New England Biolabs, #M0209), RNase H (New England Biolabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... 10 µl of RNase-free DNase I (NEB) was added to stop the reaction ...
-
bioRxiv - Immunology 2023Quote: ... 1µl T4 RNA ligase I (New England Biolabs)) was added before ligating over night at 16°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 U of beta-agarose I (NEB, M0392), and 5 μL of Maxima H minus reverse transcriptase ...
-
bioRxiv - Microbiology 2022Quote: ... and 3μL 10X DNase I buffer (NEB, B0303S) at 37°C for 15 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA template was digested by DNase I (NEB) treatment and RNA was extracted with phenol-chloroform-isoamyl alcohol (PCI) ...
-
bioRxiv - Bioengineering 2023Quote: ... with 20 U of DNase I (NEB, M0303S) for 1mL of phage lysate ...
-
bioRxiv - Cell Biology 2023Quote: ... 2ul DNA polymerase I (E.coli, NEB cat. M0209S), 0.5ul RNase H (2.5 units) ...
-
bioRxiv - Molecular Biology 2023Quote: ... An orthogonal combination of DNase I (NEB, M0303S) and incubation time were used to achieve the best cutting efficiency ...
-
bioRxiv - Plant Biology 2024Quote: ... RNA samples were digested with DNase I (NEB) to remove genomic DNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was treated with DNAse I (M0303, NEB) (1 U per 2.5 µg of RNA ...
-
bioRxiv - Bioengineering 2024Quote: ... and 10 U of DNA polymerase I (NEB) was added to the samples on ice for a final volume of 50 μl ...
-
bioRxiv - Genomics 2024Quote: Exonuclease I (New England Biolabs, cat. no. M2903)
-
bioRxiv - Immunology 2023Quote: ... Each pool was treated with Exonuclease I (NEB) for 30’ at 37°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adaptor ligated RNAs 48-58nt long (corresponding to 19-29nt long input RNAs) were extracted and ligated to the 5’ adaptor using T4 RNA Ligase 1 (NEB, M0204). A total of ten variable nucleotides (unique molecular identifiers ...
-
bioRxiv - Developmental Biology 2022Quote: ... and a 450 bp long (HAR sequence)) were introduced using the NEBuilder® HiFi DNA Assembly Master Mix (New England BioLabs) in combination with the sequences produced as gene blocks (IDT ...
-
bioRxiv - Genomics 2020Quote: Plasmids containing H2afz-FKBP.knock-in.BFP and Nelfb-Halo DNA repair templates were synthesized with long homology arms (∼800 bp) by Genewiz FragmentGene and assembled using the NEBuilder HiFi DNA Assembly Cloning kit (NEB E5520S). The Dendra2-RBP1 plasmid and guide were used as previously described10.
-
bioRxiv - Biochemistry 2019Quote: ... and a long primer (C1-EGFP-NES long forward: ttaatgtacaagggtgcatcctctgcaagtggcaacagcaatgaattagccttgaaattagcaggtcttgatatcaacaagtaagcggccgcttaa) covering the whole peptide using Polymerase chain reaction (PCR; Phusion Polymerase, New England Biolabs (NEB)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... primers pM102F and pM102R (Supplementary Table 2) were designed and used in a long-range PCR reaction using the LongAmp® Taq DNA Polymerase (NEB) to amplify 40 ng of genomic DNA following the kit instructions ...
-
bioRxiv - Microbiology 2020Quote: We tested four high-fidelity and/or long-range DNA polymerases in duplicate to evaluate improvements of read length during the amplification step: 1) NEBNext (NEB M0541), 2 ...