Labshake search
Citations for New England Biolabs :
151 - 200 of 1716 citations for Recombinant Human Glypican 3 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and dephosphorylated using recombinant shrimp alkaline phosphatase (New England BioLabs M0371L). Annealed and phosphorylated oligonucleotides were cloned into linearized and dephosphorylated BPK1520_puroR using T4 DNA Ligase (New England BioLabs M0202L ...
-
bioRxiv - Immunology 2021Quote: ... A similar dilution series of recombinant histone H3 (New England Biolabs) was prepared starting at 1 µg/ml protein ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 mM DTT with 1.5 µM recombinant H3 (New England Biolabs), vehicle or 500 nM recombinant enzyme ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant proteins were induced in SHuffle Express strains (New England Biolabs) upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant bacmids were created by transformation into DH10Bac competent cells (NEB), screening on XGAL plates ...
-
bioRxiv - Biochemistry 2024Quote: ... Protease Inhibitors) with recombinant PKA kinase (2500 U/mg, NEB-P600S) and 1 mM ATP overnight at 30°C and 250 rpm ...
-
bioRxiv - Developmental Biology 2022Quote: ... The complete insert region was PCR amplified using Q5 Hi Fidelity DNA polymerase (NEB) and the amplicon sequenced at high coverage using Illumina MiSeq in the Complete Amplicon Next-Generation Sequencing service from the MGH CCIB DNA Core (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were conducted using NEB Phusion Hi Fi Polymerase (New England Biolabs, Ipswich, MA). Reactions were comprised of 4 µl 5X Phusion Buffer ...
-
bioRxiv - Cancer Biology 2021Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C to remove of biotin from non-ligated fragment ends ...
-
bioRxiv - Biochemistry 2020Quote: ... His-SNAP-EB3 proteins were then coupled to SNAP-Cell 647-SiR dye (NEB) by incubation at 37°C for 30 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... The expression vector pET302/NT-His was digested with EcoR1 restriction enzyme (NEB R0101S) and run on a 1.5 % agarose gel ...
-
bioRxiv - Molecular Biology 2019Quote: ... 40 µg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Synthetic Biology 2019Quote: ... cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). PCR reactions were performed with the Phusion High-Fidelity PCR Master Mix with HF buffer (New England Biolabs) ...
-
bioRxiv - Genetics 2019Quote: ... These were used in a PCR reaction with Q5 Hi-Fidelity polymerase (NEB, USA) in combination with the pLuc-GAL5.1 reporter construct previously described 8 as template to produce pLuc-GALΔEGR ...
-
bioRxiv - Genomics 2019Quote: ... 40 μg of Hi-C library DNA were incubated with T4 DNA polymerase (NEB) for 4 hours at 20°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... using the NEBuilder Hi Fi DNA Assembly Master Mix (New England Biolabs, Beverly, MA). For the production of lentiviral particles ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-MBP-Cas12a plasmid was transformed into BL21(DE3) cells (New England Biolabs). A single colony was used to inoculate LB media supplemented with 50μg/ml Kanamycin for an overnight culture grown at 37°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... stained in HI buffer containing 5 μM SNAP-Surface Alexa 647 (New England Biolabs) for 15 minutes at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... and K723G).49 His/MBP-BRAF NTs were created with standard Gibson Assembly (NEB) procedure in the pET28-MBP vector from the following primers ...
-
bioRxiv - Microbiology 2022Quote: ... a custom 3’ adapter (5’-rAppCTGTAGGCACCATCAAT–NH2-3’, NEB, S1315S) was ligated to all RNAs ...
-
bioRxiv - Cell Biology 2021Quote: ... MBP-tagged protein was captured by gravity flow affinity chromatography using amylose resin (New England Biolabs). Captured protein was washed with wash buffer (50mM Tris/HCl pH 7.6 ...
-
bioRxiv - Cell Biology 2022Quote: All overexpression constructs with the internally tagged actins were generated by Gibson assembly (New England Biolabs). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR confirmation of endogenously tagged ATR cell lines was performed using NEB Taq DNA polymerase (NEB) as per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR was performed with Nextera-tagged primers under standard Phusion or Q5 Polymerase (New England Biolabs). PCR primers used in this study can be found in Supplementary Table 3 ...
-
bioRxiv - Neuroscience 2019Quote: ... pCAV-FLExloxP-Flp was incubated with recombinant Cre recombinase (New England Biolabs) and then transformed into DHα bacteria ...
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.4 µL (16 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 20 µL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.75 µL (30 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 30 µL ...
-
bioRxiv - Synthetic Biology 2021Quote: The recombinant CBX8-CD was expressed in BL21 (DE3) (New England Biolabs) Escherichia coli cells ...
-
bioRxiv - Biophysics 2021Quote: ... Recombinant M-MuLV reverse transcriptase from the ProtoScript® II kit (NEB) was used to synthesize first strand cDNA from the annealed primer-MS2 RNA mix ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant Lili-Mips were treated with PNGase F (New England Biolabs) to remove the N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were generated using HiFi DNA Assembly Cloning Kit (NEB E5520). During cloning procedures ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were constructed using HiFi DNA Assembly Cloning Kit (NEB E5520). electroporation (device) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Microbiology 2023Quote: ... His/Strep-Tag was cleaved using enterokinase according to the protocol of the manufacturer (NEB) and GlnA3Mtwas immediately purified from the digestion mix by size-exclusion chromatography as directed by the resin manufacturer (GE-Healthcare).
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified/tagged in two steps using NEBnext High-Fidelity 2x PCR master mix (New England Biolabs). Amplified DNA was purified twice with 1.8 volumes of NucleoMag NGS Clean-up and Size Select beads (Macherey Nagel) ...
-
bioRxiv - Biophysics 2020Quote: mNG-tagged ADRβ2 and EGFR were generating by cloning into the pSNAPf-ADRβ2 backbone (New England Biolabs). mNG was amplified by PCR from mNG-C1 and placed between the EcoRI and SbfI sites of pSNAPf-ADRβ2 (replacing the SNAP tag ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-GAAGTCGACCCCGGGAATGGAGCTGGA-3’ T380A 5’3’ flanking primer: 5’ GAAGGATCCTTACTTACTTAGCGGCCG 3’ Fwd.: 5’-GATGAGACTGGGGCACTCGCCCCTGCTCTTACCAGCGAG-3’ Rev.: 5’-CTCGCTGGTAAGAGCAGGGGCGAGTGCCCCAGTCTCATC-3’ BamHI and SalI restriction enzymes (New England Biolabs) were used to subclone the mutated fragment into the pRK5-myc-Arc backbone.
-
bioRxiv - Microbiology 2020Quote: ... 3 mM MgCl2 (NEB), 0.24 mg.ml−1 BSA (Fermentas) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 3 (NEB #E7710) were used to create unique identifiers for each cDNA library sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... 3 µL MNase (NEB) was added to a clarified K562 lysate from ∼5 M cells and digested for 30 minutes at 37 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... and 3’ NotI (NEB) before being tested by sequencing (Macrogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...