Labshake search
Citations for New England Biolabs :
251 - 300 of 2435 citations for Recombinant Human CD96 Protein T7 His TEV tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μl T7 RNA Polymerase Mix (NEB) in a total of 20 μl ...
-
bioRxiv - Bioengineering 2022Quote: ... T7 DNA ligase was obtained from NEB. Plasmids were transformed into competent Stbl3 chemically competent E ...
-
bioRxiv - Immunology 2023Quote: ... Novagen) into Shuffle T7 Express cells (NEB). The cells were grown in 2xYT media supplemented with 100 µg/ml ampicillin and 15 µg/ml of chloramphenicol to OD600 0.8 – 1.0 and then protein production was induced with 0.4 mM IPTG and proceeded for 16 h at 20 °C ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1U/µL T7 RNA Polymerase (NEB) and were incubated for 3 h at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... a T7 endonuclease I cutting assay (NEB) was used to identify the extent of insertions/deletions for each guide ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 U of T7 endonuclease I (NEB) was added and incubated for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... coli T7 Express strain (New England Biolabs) as described33.
-
bioRxiv - Biochemistry 2023Quote: ... coli T7 shuffle cells (New England Biolabs) after induction of protein expression by addition of isopropyl-β-D-thiogalacto-pyranoside (IPTG ...
-
bioRxiv - Microbiology 2024Quote: ... Then we used T7 Ribomax Express (NEB) in vitro RNA synthesis kit to generate single-stranded negative sense RNA that resembles the vRNA molecule ...
-
bioRxiv - Biophysics 2024Quote: ... coli SHuffle® T7 (New England Biolabs) as described (63) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Proteins (except from cells expressing eGFP and cytoplasmically tagged EGFR) were further treated with 250 U of PNGase F (NEB, Cat# P0704) for 1 hour at 37 °C ...
-
bioRxiv - Biochemistry 2020Quote: ... and RNAse free water and lastly 1.5 μL of T7 RNA polymerase (HiScribe T7 In Vitro Transcription Kit from New England Biolabs or AmpliScribe T7 High Yield Transcription Kit from Epicenter) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10x diluted T7 RNA Polymerase mix (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs, USA). After linear amplification ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 10x diluted T7 RNA Polymerase mix (HiScribe™ T7 High Yield RNA Synthesis Kit, New England Biolabs, USA). After linear amplification ...
-
bioRxiv - Microbiology 2020Quote: The replicon vectors (pSMART-T7-scv2-replicon or pSMART-T7-scv2m-replicon) were first linearized by Swa I (NEB), and then purified by phenol/chloroform extraction and ethanol precipitation ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by T7 in vitro transcription using the HiScribe T7 In Vitro Transcription Kit (New England Biolabs, Ipswich, MA) and purification with Trizol (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: The strains used in this work were T7 express and shuffle T7 express Escherichia coli cells (New England Biolabs). All strains were grown in Luria-Bertani (LB ...
-
bioRxiv - Molecular Biology 2019Quote: ... After annealing the complex an equimolar amount was mixed with 1000ng Cas9 recombinant protein (NEB; final conc 20ng/ul) and incubated at RT for 15’ ...
-
bioRxiv - Genetics 2019Quote: P2C-Cas9 and P2C-EGFP proteins were expressed from pET28a-P2C-Cas9 and pRSET-P2C-EGFP respectively by recombinant BL21 E.coli (NEB) as described in detail in Chaverra-Rodriguez et al ...
-
bioRxiv - Biochemistry 2020Quote: ... 20 μg each of the recombinant proteins were lyophilized and digested with PNGase F (P0701S, New England Biolabs Inc.) according to the manufacture’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... the 6xHis-MBP tag was cleaved from 6xHis-MBP-MISP using a TEV protease (NEB; P8112) for 1 hour at room temperature ...
-
bioRxiv - Biophysics 2023Quote: ... pFastBac HT 10xHis-MBP-TEV-FUS was constructed by the Gibson assembly (New England BioLabs E2611) of pFastBac HT ...
-
bioRxiv - Molecular Biology 2020Quote: ... Exchange of V5/His to myc/His was performed using the Q5 site-directed mutagenesis kit (NEB #E0554) according to the manufacturer’s protocol resulting in pEF1-ZAP-S-myc/His and pEF1-ZAP-L-myc/His ...
-
bioRxiv - Genomics 2020Quote: ... was transcribed from a sgRNA-coding PCR product with a 5′ T7 promoter sequence using HiScibe T7 Quick High yield RNA Synthesis kit (NEB). The transcription was performed at 37 °C overnight and then purified by phenol ...
-
bioRxiv - Microbiology 2019Quote: ... RNA specific to the DWV clones were produced in vitro with T7 RNA polymerase (HiScribe T7 RNA polymerase, New England Biolabs) using as the templates PCR fragments corresponding to the positions 1242-1524 of the clones DWV-304 and DWV-422 (GenBank accession numbers MG831200 and MG831202 ...
-
bioRxiv - Bioengineering 2021Quote: ... were synthesized using a T7 RNA polymerase in vitro transcription with the HiScribe T7 ARCA mRNA Kit (with tailing) (NEB). The mRNAs were purified using a Monarch RNA Cleanup Kit (NEB) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C.
-
bioRxiv - Molecular Biology 2020Quote: ... 4.8 mM MgCl2 and 1x reaction buffer for T7 RNAP and 62.5 units of T7 RNAP (New England BioLabs, NEB). The mixture was incubated for 2 h at 37°C ...
-
bioRxiv - Genomics 2022Quote: ... Then we performed the bead-on T7 transcription reaction by HiScribe™ T7 High Yield RNA Synthesis Kit (NEB E2040S). The amplified RNAs were processed to the PCR-cDNA sequencing kit (nanopore) ...
-
bioRxiv - Cell Biology 2022Quote: ... The assembled template was purified and subjected to in vitro transcription by T7 RNA polymerase using the Hiscribe T7 High Yield RNA Synthesis Kit (New England Biolabs). The reaction product was treated with DNase I ...
-
bioRxiv - Cell Biology 2022Quote: ... The purified DNA template was subjected to in vitro transcription by T7 RNA polymerase using the HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs). After being treated with DNase I (Takara Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Guide RNAs were cloned into a T7 promoter vector followed by in vitro transcription (HiScribe T7 High Yield RNA Synthesis Kit, New England BioLabs) and spin column purification (RNeasy ...
-
bioRxiv - Microbiology 2021Quote: The DNA template for T7 transcription was prepared by linearizing the T7 replicon plasmid (#453, Supplemental Table I) with the restriction enzyme SacII (NEB), followed by protease K treatment ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg of purified DNA of each template including the T7 promoter at the 5’ end was used following the manufacturer instructions (HiScribe T7 High Yield RNA Synthesis kit, NEB). Primers used are listed in Supplementary Table 1 ...
-
bioRxiv - Microbiology 2023Quote: ... Transcription and fluorescent labelling of RNA in vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: In vitro transcription reactions were carried out using a T7 RNA transcription kit (HiScribe T7 High Yield; New England Biolabs) with the following modifications ...
-
bioRxiv - Microbiology 2023Quote: ... we transcribed T7 promoter-pre-Let7c 5’GCTCCUUGGUUUGCTUGUUGGTTGTUCUGTTUUCTCCCUGGGTGTUUCTCTUUU CCUTUCUUCCTUCTUCCTCUUCCCGGUTGCCCTATAGTGTGAGTCGTATTA 3’ and T7-promoter-pre-miR29a 5’ATAACCGATTTCAGATGGTGCTAGAAAATTATATTGACTCTGAACACCAAAAGAAA TCAGTCCCTATAGTGAGTCGTATTA3’ using the T7 high yield RNA synthesis kit (BioLabs) with α 32P UTP (Perkin Elmer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 bp Cy3‐UTP labeled RNA was generated using a PCR‐product containing a T7‐promoter site and the HighScribe T7 high yield RNA synthesis kit (NEB) as well as Cy3‐UTP (Jena Bioscience) ...
-
bioRxiv - Immunology 2024Quote: ... pUC57-mini plasmids harboring the WT or mutated coding sequence downstream of T7 promoter were first transcribed into mRNA using the HiScribe T7 ARCA mRNA Kit (New England BioLabs) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... The 72mer Ψ-containing model RNA used for mutation analysis and the 1.8-kb 10% Ψ-modified RNA used for UHPLC-MS/MS were prepared by T7 in vitro transcription using HiScribe T7 High Yield RNA Synthesis Kit (NEB) and Pseudo-UTP (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: ... T7 promoter region was added to the 5’ end of each construct for in vitro transcription of RNA using T7 RNA polymerase from T7 HiScribe RNA synthesis kit (New England Biolabs). Synthesized RNA was subjected to DNase treatment (TURBODNase ...
-
bioRxiv - Immunology 2023Quote: ... via recombinant neuraminidase (NEB P0720L) as described by the manufacturer ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 200U (4µL) of T7 RNA polymerase (NEB, #M0251S), and 40µM DFHBI to the final volume of 100µL ...
-
bioRxiv - Biophysics 2021Quote: ... We then used T7 RNA polymerase (NEB E2040S) to transcribe sgRNA from this template and purified the sgRNA with RNAClean XP magnetic beads according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... screened using T7 Endonuclease I (New England Biolabs), and confirmed by Sanger sequencing ...
-
bioRxiv - Biochemistry 2019Quote: ... coli T7 Express (New England Biolabs, Ipswich, USA). For small-scale expression and purification of amounts sufficient to analyze protein splicing in cis and trans ...
-
bioRxiv - Cancer Biology 2019Quote: ... T7 endonuclease 1 (New England BioLabs, Cat. # M0302S) was added and incubated at °C for 15 minutes ...
-
bioRxiv - Systems Biology 2020Quote: ... 20 μL T7 DNA ligase reaction buffer (NEB), and 2 μL nuclease-free water then incubating at 37°C overnight ...