Labshake search
Citations for New England Biolabs :
551 - 600 of 1470 citations for Recombinant Human CD40 protein Fc tagged R PE labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Additional reconstitutions with linker histone were performed by mixing reconstituted 183×12 core arrays with 1 mg/ml recombinant linker histone variant H10 (New England Biolabs, cat.# M2501S) at a molar ratio of 0.7 molecule histone H1 per nucleosome in solution containing 500 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Histone yields from each purification were determined by using a calibration curve of recombinant H3 and H4 (NEB, cat. #M2503S, #M2504S, respectively). Absolute amounts of histone were determined by densitometry on coomassie-stained bands with Fiji61 for Pristionchus data (conducted at the MPI in Tübingen ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) in the presence of 0.2 mM Mg2+-ATP and 1 µCi [γ32-P]ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... in protein kinase buffer (New England Biolabs) and 0.5 mM Mg2+-ATP for 30 min at 30°C ...
-
bioRxiv - Cell Biology 2020Quote: ... Protein Phosphatase Inhibitor 2 (New England Biolabs) and Trichostatin A HDAC inhibitor (TSA ...
-
bioRxiv - Physiology 2022Quote: ... The Cas9 protein was purchased from NEB. Mixture of sgRNA (100 pg ...
-
bioRxiv - Immunology 2022Quote: ... 1μl of Lambda Protein Phosphatase (NEB, P0753S) was added and samples were incubated at 30°C for 30 minutes ...
-
LIR-dependent LMX1A/LMX1B autophagy crosstalk shapes human midbrain dopaminergic neuronal resiliencebioRxiv - Cell Biology 2019Quote: ... Proteins were transferred to nitrocellulose membranes (Biolabs). Membranes were then incubated with primary antibody diluted in 2.5% milk or 2.5% BSA in Triton X-100-TBS buffer (T-TBS ...
-
bioRxiv - Cell Biology 2020Quote: ... protein tyrosine phosphatase (PTP, 5 unit; NEB), or sodium orthovanadate (Na3VO4 ...
-
bioRxiv - Plant Biology 2021Quote: ... Lambda protein phosphatase treatment (New England BioLabs) was performed following the manufactorer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Lambda protein phosphatase (New England BioLabs, P0753S) was used per product instructions.
-
bioRxiv - Pathology 2021Quote: Magnetic protein G beads (New England Biolabs) were blocked in antibody selection buffer and used to immobilize 10-15μg polyclonal rabbit anti-VWF (Dako A0082 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were degraded using proteinase K (NEB) and RNA was purified using RNeasy maxi kit (Qiagen).
-
bioRxiv - Biochemistry 2022Quote: ... Prestained protein ladders (P7712 or P7719, NEB) on the membranes were annotated by WesternSure Pen (LI-COR).
-
bioRxiv - Developmental Biology 2022Quote: ... EnGen Spy Cas9 NLS protein (NEB, M0646) was used for F0 experiments.
-
bioRxiv - Microbiology 2023Quote: ... coli Protein Synthesis System (New England Biolabs), then purified with Ni-NTA beads (Qiagen ...
-
bioRxiv - Genetics 2023Quote: ... gRNAs and Cas9 protein (NEB, cat# M0251S) were simultaneously injected into the embryos at one-cell stage.
-
bioRxiv - Cell Biology 2024Quote: ... Protein A magnetic beads (New England Biolabs) were saturated with rabbit-anti-GFP ...
-
bioRxiv - Microbiology 2024Quote: ... coli protein synthesis system (New England Biolabs) was used for in vitro protein expression ...
-
bioRxiv - Cell Biology 2021Quote: Whole cell lysates or eluted proteins after affinity purification were treated with Protein Deglycosylation Mix II (NEB, Cat# P6044), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... so the bead-bound proteins were dephosphorylated in wash buffer containing 1:50 Lambda Protein Phosphatase (New England Biolabs) and 1 mM MnCl2 to make the phosphosites more accessible for a kinase assay ...
-
bioRxiv - Microbiology 2022Quote: ... Deglycosylation of purified protein was performed in non-denaturing conditions according to manufacturer’s protocol (Protein Deglycosylation Mix II, NEB).
-
bioRxiv - Developmental Biology 2021Quote: ... The calibrated small RNA samples were ligated to an adenylated and fluorescently labeled 3’ adaptor using T4 RNA ligase 2 truncated KQ (NEB, M0373S) and were subsequently separated on a 12% polyacrylamide UREA gel ...
-
bioRxiv - Molecular Biology 2021Quote: Telomeric duplex DNA 5′-GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGCCCCTC-3′ and antisense (5′-GAGGGGCCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC-3′ was end-labeled with [γ-32P]ATP (Amersham Biosciences) and T4-polynucleotide kinase (New England BioLabs) and purified from free nucleotides through G25 spin columns (GE Healthcare) ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting amplicons were end-labeled with [γ-32P] dATP (Perkin-Elmer) in the presence of T4 polynucleotide kinase (New England BioLabs), after which they were centrifuged through a TE Select-D G-25 spin column (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2021Quote: ... The DNA probes were complimentary to the 3′-UTR regions immediately adjacent to the poly(A) tails and were labeled with T4 PNK (NEB, M0201S) and [γ-32P]ATP (PerkinElmer) ...
-
bioRxiv - Cell Biology 2021Quote: ... and 200 ng of the purified amplicon were end-labeled using 10 µCi of γ-32P ATP (Amersham) and T4 polynucleotide kinase (NEB). The labeling reaction was then desalted on a G-25 spin column and further precipitated with 70% ethanol ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The single-stranded labeled probes were finally cleaned up using the Monarch PCR & DNA cleanup kit (New England Biolabs®, T1030) following the oligonucleotide cleanup protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 32P were then labeled to 5’ end of digested RNA by T4 Polynucleotide Kinase (PNK) (New England Biolabs, Cat. No. M0201S). After labelling ...
-
bioRxiv - Genetics 2022Quote: ... Specific sRNAs were detected by hybridization with DNA oligonucleotides labeled at their 5’ termini with [γ-32P]ATP and T4 Polynucleotide Kinase (New England Biolabs) as previously described (Ibrahim et al. ...
-
bioRxiv - Genomics 2022Quote: The 2.2 kb DNA was ligated with 1 kb biotin- and dig-labeled DNA through SbfI- and XbaI-overhangs by T4 DNA ligase (NEB Biolabs). The ligated products were attached to the anti-dig treated surface of reaction chamber and streptavidin-coated magnetic beads ...
-
bioRxiv - Cell Biology 2023Quote: ... The odf3l2a template was amplified from total RNA with T3 and T7 sites on the forward and reverse primers respectively and the DIG-labeled antisense probe was synthesized directly from purified PCR product using T7 RNA polymerase (NEB M0251S). The ankef1a and saxo2 probe templates were amplified from total RNA with gene specific primers and cloned into the pCR4-TOPO vector (Thermo Fisher 450071) ...
-
bioRxiv - Biochemistry 2023Quote: ... oligonucleotide X12-3 HJ3 (93 nt) was labeled at the 5’ terminus with [γ-32P] (Hartmann-Analytic) and T4 polynucleotide kinase (New England Biolabs), according to standard protocols65 ...
-
bioRxiv - Microbiology 2023Quote: ... DNA probes complementary to the sequence of each sRNA were end-labeled with [μ-32P]dATP (Perkin-Elmer) and T4 polynucleotide kinase (New England BioLabs) as described before (28 ...
-
bioRxiv - Microbiology 2023Quote: ... and vcircRNA873/1151 (oligonucleotide probe 5’- CAGGACAACAGGGCCAGCAAGGTGGCGGACATCACAACCA-3’ against the junction) were performed using γ-32P-dATP-end labeled (PNK kinase, NEB) probes ...
-
bioRxiv - Biochemistry 2023Quote: ... The indicated oligonucleotides were labeled at the 3’ terminus with [α-32P] dCTP (Hartmann-Analytic) by terminal transferase (New England Biolabs) prior to annealing ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were live labeled with 1 μM ATTO 590-chloroalkane and 1 μM of SNAP-Cell 647-SiR (New England Biolabs; S9102S) (final concentrations) ...
-
bioRxiv - Genetics 2023Quote: ... using a biotin-labeled 30 μM dNTP mix (dATP, dGTP, dTTP and Biotin-14-dCTP Thermo Fischer, 19518018) and Klenow enzyme (NEB, M0210L) at 37°C for 80 min ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA oligonucleotides complementary to miRNA sequences were end-labeled with γ-32P-ATP using T4 PNK (New England Biolabs, Beverly, MA).
-
bioRxiv - Cell Biology 2024Quote: ... were obtained from HeLa cells co-transfected with mGFP-Sec16L at 3 µg/µL and FLAG-TFG-SNAP at 1 µg/µL and subsequently labeled with SNAP-Cell 647-SiR (NEB, S9102S) and immunostained with anti-GM130 ...
-
bioRxiv - Microbiology 2024Quote: ... The PS oligonucleotide (5’-CGCGGGCCTCTACAACCGGCACCGTG) was synthesized by IDT and 5’-labeled with [γ-32P]ATP and T4 polynucleotide kinase (NEB) to generate the [32P]PS probe ...
-
bioRxiv - Molecular Biology 2019Quote: ... Purified human gDNA was digested with the restriction enzyme HaeIII (NEB, Ipswich, Massachusetts) per the manufacturer’s instructions to yield an average of 347-bp DNA fragments22 ...
-
bioRxiv - Genomics 2019Quote: ... mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA, USA). E14 genomic DNA was extracted with a DNeasy Blood and Tissue Kit (QIAGEN ...
-
bioRxiv - Genetics 2020Quote: ... following rRNA depletion using a NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (NEB).
-
bioRxiv - Molecular Biology 2023Quote: ... Human FBP1 mutants were constructed by Q5 Site-Directed Mutagenesis Kit (NEB, E0554S) in the PCDH-V5-FBP1 vectors ...
-
bioRxiv - Genomics 2019Quote: ... Pools were PCR amplified using 10uM Illumina primer pair (F+R) and 2X Phusion Master Mix (NEB #M0531), temperature cycling consisted of 98°C for 30s ...
-
bioRxiv - Microbiology 2021Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Microbiology 2020Quote: ... using primers targeting the E gene of SARS-CoV-2 (E_Sarbeco-F ACAGGTACGTTAATAGTTAATAGCGT; E_Sarbeco-R ATATTGCAGCAGTACGCACACA) and Luna Universal One-Step qRT-PCR Kit (New England Biolabs) on a Roche Light Cycler 480 ...
-
bioRxiv - Molecular Biology 2021Quote: ... R: 5’-ccgggaaaaactgaaaaaccattggcacgacaggtttcccgac-3’ from the pKAM555 vector) was inserted at the ClaI site using HiFi assembly (NEB). For the intTEL0 strain creation the pUC19LG plasmid (lacking the PstI(blunted)-BclI fragment of the HARS36 sequence ...
-
bioRxiv - Genetics 2023Quote: ... The T7 promoter and mtdTomato CDS were amplified from pmrPTRE-AAV using PTRE_floxed_F/R and Phusion High-Fidelity PCR Master Mix (NEB). NotI and SalI sites added by the primers were used to subclone this amplicon into pRM1506_TMM432 ...