Labshake search
Citations for New England Biolabs :
251 - 300 of 788 citations for Recombinant Human CD3E & CD3D His & Flag tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... the recombinant proteins were purified by amylose resin (#E8022S, New England Biolabs) according the manual instructions ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.4 µL (16 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 20 µL ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 0.75 µL (30 U) of recombinant RNase inhibitor (New England Biolabs) in a final volume of 30 µL ...
-
bioRxiv - Synthetic Biology 2021Quote: The recombinant CBX8-CD was expressed in BL21 (DE3) (New England Biolabs) Escherichia coli cells ...
-
bioRxiv - Biophysics 2021Quote: ... Recombinant M-MuLV reverse transcriptase from the ProtoScript® II kit (NEB) was used to synthesize first strand cDNA from the annealed primer-MS2 RNA mix ...
-
bioRxiv - Cell Biology 2020Quote: Recombinant GFP-fusion proteins were purified from BL21(DE3) cells (NEB, # C2527H) using an N-terminal H6-tag ...
-
bioRxiv - Biochemistry 2022Quote: The recombinant Lili-Mips were treated with PNGase F (New England Biolabs) to remove the N-linked oligosaccharides ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were generated using HiFi DNA Assembly Cloning Kit (NEB E5520). During cloning procedures ...
-
bioRxiv - Microbiology 2023Quote: ... Recombinant vectors were constructed using HiFi DNA Assembly Cloning Kit (NEB E5520). electroporation (device) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The cloning was performed with the NEBuilder Hi Fi DNA Assembly kit (New England Biolabs). The enzymes mentioned were purchased from New England Biolabs ...
-
bioRxiv - Biochemistry 2021Quote: C-terminally (His)6-tagged LukE was expressed in BL21 (DE3) Escherichia coli cells (NEB). Transformed cells were grown at 37 °C in Terrific broth supplemented with 100 μg/mL ampicillin to a density of OD600 = 0.6 ...
-
bioRxiv - Immunology 2023Quote: In situ Hi-C experiments were performed as previously described2 using restriction enzyme MboI (NEB) with minor modifications ...
-
bioRxiv - Genomics 2023Quote: ... pooled oligonucleotides were amplified via PCR using NEBNext 2X Hi-Fi PCR Master Mix (NEB) and primers:
-
bioRxiv - Cancer Biology 2024Quote: ... Hi-C libraries were treated with T4 DNA Polymerase (New England Biolabs, catalog No. M0203) to remove biotin from unligated ends ...
-
bioRxiv - Immunology 2022Quote: ... periplasmic expression vectors with C-terminal HA-His6 tags using Gibson cloning (New England Biolabs). Nanobodies were produced in Escherichia coli WK6 transformed with the respective expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with SNAP-tag ligand SNAP-Cell 647-SiR (New England BioLabs; S9102S) at a final concentration of 100 nM for 15 minutes followed by 30-45 minute washout in i3Neuron Maintenance Media before imaging in i3Neuron Imaging Media ...
-
bioRxiv - Plant Biology 2023Quote: AtPAXX fused to a hexahistidine tag (pHAT4-atpaxx) was expressed in BL21(DE3) cells (NEB). The proteins were purified using Ni-NTA (Qiagen) ...
-
bioRxiv - Biophysics 2023Quote: ... and BG-oligonuculeotides were labeled with myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer ...
-
bioRxiv - Systems Biology 2023Quote: ... Biotinylated oligo tags were amplified on-bead using 2X Q5 Hot-Start Mastermix (NEB #M0494) with primers that add the indexed full Illumina adaptor sequences.
-
bioRxiv - Cell Biology 2023Quote: ... and an internal ribosomal entry site driven SNAP-tag (N9181S, New England BioLabs, Ipswich, MA), respectively ...
-
bioRxiv - Biochemistry 2024Quote: Constructs bearing a C-terminal cMyc tag were cloned by site-directed mutagenesis (NEB, M0554S) using oligonucleotides as primers bearing a 5’-overhang encoding the inserted sequence ...
-
bioRxiv - Molecular Biology 2022Quote: ... The modified pcDNA3-3×-FLAG have been digested with EcoRI & NotI (NEB) and the pcDNA3-V5 vector has been digested with KpnI & BamHI ...
-
bioRxiv - Genetics 2019Quote: ... Flag-Mad-8 was generated by PCR followed by Gibson assembly (NEB) and the S359L substitution was verified by sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... DmMIC10b(C64S)-FLAG were produced using the Site-Directed Mutagenesis Kit (NEB) and the oligonucleotides given below.
-
bioRxiv - Molecular Biology 2019Quote: ... or without 350 units of recombinant GSK3β (rabbit skeletal muscle) (New England BioLabs) and 1X hot kinase buffer (50mM Tris ...
-
bioRxiv - Cell Biology 2019Quote: ... Recombinant MBP-Megator fragments were purified with amylose magnetic beads (New England Biolabs) and eluted in Column Buffer supplemented with 10mM Maltose ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant proteins were affinity-purified using amylose resin using the manufacturer’s protocol (NEB) and eluted with 20 mM maltose ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15μL of myc-eIF6-bound beads were incubated with/without recombinant GSK3β (NEB) and suspended in cold kinase buffer and incubated at 30°C for 30 minutes ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 mM CaCl2) at room temperature in the presence of recombinant enteropeptidase (NEB) at 13 U enzyme per mg TMPRSS2 zymogen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant protein was sequentially purified using an amylose column (New England Biolabs) followed by a nickel-nitrilotriacetic acid column (Qiagen ...
-
bioRxiv - Genomics 2024Quote: ... 200 µg/mL molecular biology grade recombinant albumin (rAlbumin) (New England Biolabs B9200S), 0.8 U/µL RiboLock RNase inhibitor (Thermo Fisher Scientific EO0384) ...
-
bioRxiv - Immunology 2021Quote: ... In-vitro-transcription was carried out using the Hi-Scribe RNA transcription kit (New England BioLabs). Briefly ...
-
bioRxiv - Molecular Biology 2021Quote: ... concentrations measured using Qubit 1X dsDNA HS Assay) was treated with 5U of RNAse HI (NEB) in RNAse HI buffer for 30 min at 37°C and then nucleic acids were purified with GeneJET Gel Extraction and DNA cleanup micro kit (General cleanup protocol ...
-
bioRxiv - Synthetic Biology 2020Quote: ... ENTR and DEST vectors were generated using Gibson assembly (NEB Builder Hi-Fi DNA assembly #E2621S) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 100 μg of His-PKR was dephosphorylated using 3,200 units of λ-PPase (New England Biolabs) in 200 μl reaction buffer (50 mM HEPES ...
-
bioRxiv - Biochemistry 2022Quote: ... the refolded 6×His-tagged precursors were treated with enterokinase (New England Biolabs, Ipswich, MA, USA) to remove their N-terminal 6×His-tag according to our previous procedure [3,18] and purified by HPLC using an analytical C18 reverse-phase column (Zorbax 300SB-C18 ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids for the trans-Tango components were generated using the Hi-Fi DNA Assembly (NEB #E5520S), BP Gateway Cloning (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... Hi-C single-index library preparation was performed as previously described56 using MboI (New England Biolabs) restriction enzyme.
-
bioRxiv - Microbiology 2023Quote: ... 750-basepair regions flanking each gene were amplified by PCR and Hi-Fi DNA Assembly (NEB) was used to clone into pExchange-tdk ...
-
bioRxiv - Genomics 2024Quote: ... The Hi-C libraries were amplified for 11–15 cycles with Q5 master mix (NEB, M0492L) following the operation manual ...
-
bioRxiv - Cell Biology 2021Quote: ... the 6xHis-MBP tag was cleaved from 6xHis-MBP-MISP using a TEV protease (NEB; P8112) for 1 hour at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... The HA protein tag and point mutations were introduced using the KLD Enzyme mix (NEB M0554S) and were verified by Sanger sequencing and whole-plasmid sequencing (Plasmidsaurus).
-
bioRxiv - Cell Biology 2023Quote: ... with C-terminal fluorescent tags using seamless cloning (HiFi DNA Assembly Master Mix, New England Biolabs). The pLVX-KRT5-mNG-IRES-Puro construct includes an mNeonGreen (Allele Biotechnology)6 sequence in-frame with the KRT5 sequence separated by a short peptide linker (DPAFLY) ...
-
bioRxiv - Cancer Biology 2023Quote: ... followed by simultaneous overnight tag cleavage by TEV and dephosphorylation by λ-protein phosphatase (NEB, P0735). The cleaved ...
-
bioRxiv - Biochemistry 2023Quote: ... the Myc/DDK tag was removed via the Q5 site-directed mutagenesis kit (New England Biolabs) using the oligonucleotides mS29 ΔMyc-DDK Forward ...
-
bioRxiv - Plant Biology 2024Quote: ... Mixed tissue sections and reaction reagents: 2 μl 10× Tag DNA polymerase (NEB, Cat. No. M0267V), 0.4 μL Buffer Tag DNA polymerase (5 U/μL ...
-
bioRxiv - Systems Biology 2024Quote: ... human (E6320, New England Biolabs, USA) and sequenced on a MiSeq (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Placenta (M0307, New England Biolabs) and 25 U of M-MuLV Reverse Transcriptase with corresponding buffer (M0253 ...
-
bioRxiv - Molecular Biology 2019Quote: ... RACK1-FLAG expression construct was PCR-amplified from cDNA with Phusion polymerase (NEB) with primers CACCATGACTGAGCAGATGACCCTTCGTG TTATCACTTATCGTCGTCATCCTTGTAATCGCGTGTGCCAATGGTCACCTGC CAC and cloned into pENTR D-TOPO vector ...
-
bioRxiv - Cell Biology 2021Quote: Myc- and DDK (FLAG)-tagged Hemopexin mRNA was transcribed from an AgeI (NEB) linearised plasmid using T7 RNA polymerase (Promega) ...