Labshake search
Citations for New England Biolabs :
301 - 350 of 468 citations for Recombinant Human CD3D Flag and Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4(wACBD5_FFAT)/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Microbiology 2021Quote: ... DGRC) downstream of and in-frame with the 3X FLAG tag using Gibson assembly (HiFi DNA assembly mix, NEB). Expression of FLAG-tagged DNMT2 in fly cells was confirmed using qRT-PCR and Western Blots using an anti-FLAG monoclonal antibody (SAB4301135 - Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... downstream of and in-frame with the 3X FLAG tag using the native restriction sites AgeI and NheI (NEB). Expression of both FLAG-tagged AaDNMT2 in mosquito cells was confirmed using qRT-PCR and Western Blots using an anti-FLAG monoclonal antibody (SAB4301135 - Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... ICL3 and S305A mutations were generated using back-to-back primers on pCDNA3.1-HCAR1-Flag vector by Q5 Site-Directed Mutagenesis Kit (NEB). Fluorogen activating peptide fusion to HCAR1 was synthesized with insertion of HCAR1 using BsmI site into pMFAP-β1 vector (Spectragenetics) ...
-
bioRxiv - Biophysics 2022Quote: ... The C-terminal Flag tag was introduced into pcDNA3.1-Spike-WT thanks to NEBuilder® HiFi DNA Assembly (NEB). The Flag tag was added during amplification of Spike-WT from pcDNA3.1-Spike-WT with the primers ...
-
bioRxiv - Molecular Biology 2023Quote: ... pLenti-PGK-ATP6V1H(Δ176-191)-FLAG-Puro was produced using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs). M4P-EGFP-LC3B and pOGP were kind gifts from F ...
-
bioRxiv - Genomics 2023Quote: ... catalog #FC-131-2001 and #FC-131-2004) using ≈15 ng of first-round PCR product as template and NEBNext Polymerase (New England Biolabs, catalog #M0541S). Final libraries were quantified via Qubit (Qiagen ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Developmental Biology 2021Quote: ... After annealing the complex an equimolar amount was mixed with 1000 ng Cas9 recombinant protein (NEB; final concentration 20 ng/μL) and incubated at RT for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant cohesinWT or cohesin3D (25 nM) were incubated with 50 nM NIPBL-MAU2 and 10 ng/μl λ-DNA (NEB, N3011S) in ATP reaction buffer consisting of 20 mM NaH2PO4/Na2HPO4 pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Molecular Biology 2023Quote: ... Unligated 3’ linker was removed by incubating the samples with the 5’-deadenylase KmHnt3 (see Recombinant protein expression and purification) and RecJ exonuclease (New England Biolabs, M0264S) for 45 min at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids encoding HA-tagged LC3B proteins were generated by replacing the EGFP sequence in the EGFP plasmids with an HA-tag followed by a Tobacco etch virus protease sequence recognition site and a Flag-Tag (Genewiz) using AgeI and HindIII (New England Biolabs). Lipidation-deficient LC3B proteins were generated by mutagenic PCR using Q5 Hot Start High-Fidelity Master Mix (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: ... trcP or fragments of the trcP ORF were cloned into pHL100’s SmaI site with the 23 nt upstream sequence and the Flag tag sequence on the C-terminal using NEBuilder HiFi DNA Assembly Master Mix (NEB); subsequently ...
-
bioRxiv - Cell Biology 2019Quote: ... the eGFP-FLAG-HA-MLKS2 sequence was PCR amplified with att flanking primers (Table S2) using high fidelity Q5 polymerase (NEB) and cloned into pDONR221 vector by BP cloning (Cat ...
-
bioRxiv - Biochemistry 2019Quote: ... were generated as described previously.23 In vitro transcription/translation of (fMVF-Flag was carried out using the combination of PureExpress (ΔtRNA, Δaa (E6840S)) and PureExpress (Δribosome (E3313S)) kits (NEB) with the following modifications ...
-
bioRxiv - Genetics 2021Quote: ... FAN1 variants were introduced in the pFASTBAC1-GST-FAN1-FLAG-His plasmid by site-directed mutagenesis using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs). Confirmed by DNA sequencing ...
-
bioRxiv - Cancer Biology 2020Quote: The Flag-HA-USP18WT construct was purchased from Addgene (#22572) and the Flag-HA-USP18C64R/C65R construct was generated using the Q5® Site-Directed Mutagenesis Kit (NEB, E0554S) and the primers OL87 ...
-
bioRxiv - Cell Biology 2021Quote: ... A 12xHis tag was cloned into the N-terminus of pcDNA3.1-MICAL1-FLAG using Q5® Site-Directed Mutagenesis Kits (New England BioLabs) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... COS-7 cell lysates from FLAG-ACBD4/5 (mFFAT) expressing cells were treated for 1 h with λPP (New England BioLabs) as described above ...
-
bioRxiv - Cancer Biology 2019Quote: ... was cloned into a pLenti-hygro backbone to create pLenti hygro Myr FLAG AKT1 (CA AKT) using standard Gibson cloning (NEB).
-
bioRxiv - Biophysics 2022Quote: ... The pACEbac1 XSMC1 XSMC3-Halo-Flag and pIDC XRAD21-8xHis were then combined by a Cre recombinase reaction (New England Biolabs). To generate the baculoviruses ...
-
bioRxiv - Cell Biology 2022Quote: ... To generate pcDNA5/FRT-Tg-NLuc plasmids the Tg gene was amplified from the pcDNA5/FRT-Tg-FLAG plasmid and assembled with the NLuc fragment using a HiFi DNA assembly kit (New England BioLabs). To generate the respective mutant construct plasmids for A2234D and C1264R Tg ...
-
bioRxiv - Neuroscience 2022Quote: ... and MATR3(S85C) from pGW1 FLAG-MATR3-EGFP constructs61 using Q5 Hot Start High-Fidelity DNA Polymerase (New England Biolabs) and flanking primers that eliminated linker sequences and EGFP ...
-
bioRxiv - Microbiology 2022Quote: ... which was assembled with oligo DNA containing Myc or FLAG tag sequence using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). The resultant plasmids were named pcDNA3-C-Myc or pcDNA3-C-FLAG ...
-
bioRxiv - Neuroscience 2023Quote: The EEF1A2 CDS was cloned into pcDNA3.1-FLAG (gift from Saunders Lab) using NEBuilder® HiFi DNA Assembly Cloning Kit (NEB) according to the protocol of the manufacturer ...
-
bioRxiv - Bioengineering 2023Quote: ... TADs were directly fused to the N-terminus to dCas9 by digesting the FLAG-NLS-MCS-linker-dCas9 plasmid with AgeI (NEB) and then cloning in PCR-amplified TADs using NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Microbiology 2023Quote: Epitope-tagged constructs using the GST tag or the 3X FLAG tag were generated using the HiFi DNA Assembly cloning kit (NEB). MntS was cloned into pGEX-6-1 and the GST-MntS fusion was subcloned into pKT25c such that the resulting plasmid lacked the T25 region ...
-
bioRxiv - Biochemistry 2023Quote: ... 250 ng Golden Gate vector (pcDNA3-based carrying a twin Strep-FLAG tag, synthesized by BioCat, Heidelberg, Germany) 2 U BSA HFv2 (NEB), 1 U T4 ligase (NEB ...
-
bioRxiv - Cell Biology 2022Quote: ... All hybrid constructs were tested for expression and cloned into the pcDNA5/FRT/TO-N-FLAG-hBirA* using restriction enzymes: 5’ KpnI (NEB) and 3’ NotI (NEB ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Genetics 2021Quote: ... and assembly of the recombinant vector was performed with the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, Ipswich, MA, USA). To generate the double ΔnoxA Δyap1 knockout mutant ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Additional reconstitutions with linker histone were performed by mixing reconstituted 183×12 core arrays with 1 mg/ml recombinant linker histone variant H10 (New England Biolabs, cat.# M2501S) at a molar ratio of 0.7 molecule histone H1 per nucleosome in solution containing 500 mM NaCl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Histone yields from each purification were determined by using a calibration curve of recombinant H3 and H4 (NEB, cat. #M2503S, #M2504S, respectively). Absolute amounts of histone were determined by densitometry on coomassie-stained bands with Fiji61 for Pristionchus data (conducted at the MPI in Tübingen ...
-
bioRxiv - Synthetic Biology 2019Quote: ... A FLAG surface tag was C-terminally appended to MxEnc and QtEnc using Q5® Site-Directed Mutagenesis (New England Biolabs). QtEncFarn was generated by appending a minimal C-terminal farnesylation signal (GCMSCKCVLS ...
-
bioRxiv - Immunology 2022Quote: ... the p300 core domain from plasmid pLV-dCas9-p300-P2A-PuroR67 was switched to a VPRmini49-FLAG with Gibson Assembly after BAMHI-HF (NEB, R3136S) digestion to generate pLV-dCas9-VPRmini ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The ZEB2 ORF was amplified with primers ZEB2_IndOE_F & _R and tagged with GFP-Flag by Gibson assembly into the pT2-CAG-MCS-2A-Puro plasmid linearized by restriction digestion with EcoRI (NEB, R3101S) and AgeI (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... A STOP codon was introduced at the end of the coding sequence of FLAG-UBE2K using the Q5 Site-Directed Mutagenesis Kit (E0554S, New England Biolabs GmbH) according to the manufacturer’s instructions and the primers TGATTGGACCCAGCTTTCTTG and GTTACTCAGAAGCAATTCTG.