Labshake search
Citations for New England Biolabs :
451 - 500 of 1402 citations for Recombinant Human CD33 protein Fc tagged APC labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... including protein disulfide bond enhancer (NEB) and GamS (NEB) ...
-
bioRxiv - Genomics 2024Quote: ... 90 nM of SpCas9 protein (NEB), NEB buffer 3.1 (NEB ...
-
bioRxiv - Genomics 2023Quote: ... catalog #FC-131-2001 and #FC-131-2004) using ≈15 ng of first-round PCR product as template and NEBNext Polymerase (New England Biolabs, catalog #M0541S). Final libraries were quantified via Qubit (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE ...
-
bioRxiv - Microbiology 2019Quote: ... 1 pmol of DNA template was mixed with 10 pmol of oligonucleotide 9 labeled with Yakima Yellow and 1µL of HemoKlen Taq DNA Polymerase (New England Biolabs) in a 6µL reaction mixture containing 50 mM Tris-HCl pH 9.0 ...
-
bioRxiv - Biochemistry 2021Quote: ... S121A or triple mutant (AAA)) was incubated and labeled in vitro with 2U of CK2 (New England Biolabs, P60105) in a 30µl reaction containing 3pM adenosine triphosphate (ATP) ...
-
bioRxiv - Microbiology 2022Quote: ... Oligonucleotides complimentary to the target were end-labeled with γ-32P-ATP by T4 polynucleotide kinase (New England Biolabs). Labeled oligonucleotides were added to the membrane and incubated overnight at 45°C ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: INS-1 832/3-SNAP-GLP-1R cells on Thermanox coverslips (Agar Scientific) were labeled with 2 μM SNAP-Surface-biotin (a gift from Dr Ivan Corrêa Jr, New England Biolabs), and 5 μg/ml NaN3-free Alexa Fluor 488 Streptavidin ...
-
bioRxiv - Molecular Biology 2020Quote: ... The immunoprecipitated RNA was 5’-end-labeled with 32P using T4 polynucleotide kinase (New England Biolabs catalogue number M0201L), separated using 4–12% BisTris-PAGE and transferred to a nitrocellulose membrane (Protran) ...
-
bioRxiv - Genetics 2020Quote: ... Open chromatin DNA was labeled with biotin by incubating the nuclei in presence of 2.5 U of Nt.CviPII (NEB, R0626S), 50 U of DNA polymerase I (NEB ...
-
bioRxiv - Cancer Biology 2023Quote: ... Oligonucleotide probe for telomere or Alu repeats was labeled with [32P]-ATP (3,000 Ci/mmol) and T4 nucleotide kinase (New England Biolabs). The membrane was hybridized in Church hybridization buffer containing a 32P-labeled probe at 42°C overnight ...
-
bioRxiv - Biophysics 2023Quote: RNAs were labeled with γ32P-ATP using T4 polynucleotide kinase (PNK) according to the manufacturer conditions (New England Biolabs). Radioactive RNAs were separated from any non-incorporated γ32P-ATP via denaturing 15% polyacrylamide (19:1 ...
-
bioRxiv - Genomics 2023Quote: ... cells in the latter plate were labeled with HaloTag Oregon Green and SNAP-Cell 647-SiR (New England Biolabs) simultaneously according to the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2024Quote: ... DNA was labeled by fill-in of EcoRI overhangs with the DNA polymerase I Klenow fragment (New England Biolabs) in the presence of [α-32P] dATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2023Quote: Isotope labeled firefly luciferase (Fluc) mRNA was synthesized by HiScribe T7 High Yield RNA Synthesis Kit (E2040S, NEB, Ipswich) using stable heavy isotopes of ATP and CTP (NLM-3987-CA and CNLM-4267-CA-20 ...
-
bioRxiv - Neuroscience 2022Quote: ... Final concentrations of 5 µM TDP-43-TEV-MBP and the indicated final concentrations of recombinant proSAAS or BSA (NEB BioLabs; B9001S) were achieved by mixing aliquots of a 44 μM stock solution of TDP-43-TEV-MBP with aliquots of stock solutions of either 55 μM proSAAS or 151 μM BSA (both in 5 mM acetic acid) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The amplified PCR products were ligated into the recombinant plasmid pZE0-P-MglE-T using the recommended standard USER cloning protocol (NEB, UK).
-
bioRxiv - Cell Biology 2022Quote: Phase separation of purified recombinant Cdc15-IDR-SH3 co-expressed with Pom1 was induced by treatment with α-phosphatase (NEB; P0753L) and dilution to physiological salt concentrations (50 mM Tris pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: The antibody expression vectors for each recombinant antibody (VH + VL-L/k) were transfected together with a Transposase vector (Hera BioLabs, USA). Cells were selected with Hygromycin B (H3274 ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant cohesinWT or cohesin3D (25 nM) were incubated with 50 nM NIPBL-MAU2 and 10 ng/μl λ-DNA (NEB, N3011S) in ATP reaction buffer consisting of 20 mM NaH2PO4/Na2HPO4 pH 7.5 ...
-
bioRxiv - Cancer Biology 2023Quote: ... When needed the mRNA was polyadenylated after transcription using a recombinant poly-A polymerase as recommended by the manufacturer (NEB Biolabs).
-
bioRxiv - Microbiology 2024Quote: ... All recombinant plasmids in this study were constructed with NEBuilder Hifi DNA Assembly Master Mix (New England Biolabs, Ipswich, Massachusetts, USA). All oligonucleotides were ordered and all sequencing works were done at Eurofins Genomics (Ebersberg ...
-
bioRxiv - Plant Biology 2020Quote: ... The NRPD1-Maltose Binding Protein (MBP) fusion protein was affinity purified using Amylose resin (New England Biolabs) and eluted with 20 mM maltose ...
-
bioRxiv - Biochemistry 2024Quote: ... the concentrated protein at 3 mg/mL was incubated with c-AMP Protein Kinase A PKA (NEB) (molar ratio of 40:1 ...
-
bioRxiv - Genomics 2019Quote: ... Human genomic DNA was fragmented by a dsDNA fragmentase (New England Biolabs) followed by end preparation and adapter ligation according to the NEBNext Ultra II DNA Library Prep Method for Illumina (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... or the NEBNext® rRNA Depletion Kit (Human/Mouse/Rat)(E6350, NEB) (replicates 4-5 and no salt treatment ...
-
bioRxiv - Biochemistry 2022Quote: ... The coding region of human Cdc20N was cloned by USER® (NEB) into a modified pRSFDuet-1 vector (71341-3 ...
-
bioRxiv - Microbiology 2022Quote: ... or PCR amplified from human cDNA using Vent Polymerase (New England Biolabs), then introduced into the luciferase with an intron construct at the EcoRI site ...
-
bioRxiv - Genomics 2020Quote: Mouse NIH/3T3 and human Jurkat DNA were from NEB (Ipswich, MA), and XP12 phage DNA was obtained from Dr ...
-
bioRxiv - Molecular Biology 2022Quote: ... we used NEBNext® rRNA Depletion Kit (Human/Mouse/Rat) (NEB #E7405), NEBNext® Ultra™ II Directional RNA Library Prep Kit for Illumina® (NEB #E7765 ...
-
bioRxiv - Genetics 2023Quote: ... using the NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) (NEB E7405) or the NEBNext Poly(A ...
-
bioRxiv - Genomics 2020Quote: ... The first step involved incubation of total DNA with proteinA-MBD2-Fc mixture (NEBNext Microbiome DNA Enrichment Kit, New England BioLabs, Microbial enrichment kit, New England Biolabs, Cat No. E2612L), which binds and depletes methylated nuclear DNA fragments ...
-
bioRxiv - Microbiology 2022Quote: ... the membranes were hybridized overnight with antisense oligo probes listed in the S6 Table end-labeled with T4-PNK (New England Biolabs) using 32P-γ-ATP (Perkin Elmer) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The SNAP-tagged histones neosynthesized during the chase time were pulse-labeled by incubating cells with 2 μM of red-fluorescent SNAP reagent (SNAPcell TMR star, New England Biolabs) for 15 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 5’-hydroxyl standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with calf intestinal phosphatase (NEB). The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE ...
-
bioRxiv - Molecular Biology 2019Quote: ... The cap 0 standard was generated by treating the 5’-triphosphate/3’-FAM-labeled 25mer with Vaccinia virus capping enzyme (VCE, NEB) in the presence of GTP and S-adenosylmethionine (SAM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The 25mer Cap 1 RNA was generated by treating the chemically synthesized 3’-FAM-labeled Cap 0 25mer RNA with mRNA Cap 2’-O-Methyltransferase (NEB) in the presence of SAM ...
-
bioRxiv - Microbiology 2021Quote: ... was dephosphorylated and 5’ end labeled with P32 as follows: 25 pmol of RNA was dephosphorylated using 50U of Antarctic Phosphatase (NEB) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... One of the strands of each sequence was then labeled with P32 as follows: 10 pmols of single stranded DNA was incubated with 5 Units of T4 PNK (NEB) and 0.64µCi of P32- γ -ATP (Perkin-Elmer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The splicing isoforms were then amplified with minigene-specific primers (F: CTGGCTAACTAGAGAACCCACTGC; R: GGCAACTAGAAGGCACAGTCG) and 32P-labeled dCTP using Q5 High-Fidelity DNA Polymerase (New England Biolabs) following the manufacturer′s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... pJET1.2 plasmids containing 150 bp FCR monomer sequences were PCR-amplified and fluorescently labeled using random hexamer priming and Klenow (exo-) polymerase (New England Biolabs). Both Alexa Fluor 488 and 568 dUTP-conjugated fluorophores were used ...
-
bioRxiv - Molecular Biology 2020Quote: Gene-specific primers (Supplementary Table 4) were labeled with [γ-32P]ATP by phage T4 polynucleotide kinase (New England Biolabs), as recommended by the manufacturer ...
-
bioRxiv - Immunology 2020Quote: ... A 32P-labeled 368 nt transcript was generated from EcoRI digested probe temple (described below) using T7 RNA polymerase (New England Biolabs). The probe was diluted in the hybridization buffer described above ...
-
bioRxiv - Biochemistry 2019Quote: ... 10 pmol of oligonucleotide was labeled at the 5’ terminus with 0.05 mCi [γ-32P]-ATP using T4 Polynucleotide Kinase (New England Biolabs). For annealing ...
-
bioRxiv - Molecular Biology 2019Quote: ... About 20picomoles of CIP treated RNA was 5’ end labeled with 50μCi of [γ-32P] ATP (10mCi/ mL, BRIT, India) by incubating with T4 polynucleotide kinase (New England Biolabs) at 37°C for 35 min ...
-
bioRxiv - Biophysics 2019Quote: ... and 15-25 μM of BG-oligonuculeotides were labeled with ∼ 1 μM myosin II containing a C-terminal SNAP-tag (NEB) in anion-exchange elution buffer for 30 min at room temperature ...
-
bioRxiv - Zoology 2020Quote: ... Each gel also contained 32P-end-labeled size ladders (Molecular Weigh Marker XV, by Roche Diagnostics and 1Kb DNA ladder by New England Biolabs). After electrophoresis ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1) (NEB) and amplified 7 cycles by PCR in the presence of SYBR Green in order to obtain an optimal yield ...
-
bioRxiv - Molecular Biology 2019Quote: ... Each of the libraries was labeled by a specific barcode provided in NEBNext Multiplex Oligos for Illumina (Index Primers Set 1 and 2) (NEB) and amplified 9-13 cycles (depending on initial material amount ...
-
bioRxiv - Molecular Biology 2020Quote: ... tRF-5s, itRFs were end-labeled with 32P-ATP (Board of Radiation and Isotope Technology, India) using polynucleotide kinase (NEB), purified through MicroSpin G-25 Columns (GE Healthcare) ...