Labshake search
Citations for New England Biolabs :
51 - 100 of 10000+ citations for Rat Oxidation resistance protein 1 Oxr1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: Experiments with PURExpress in vitro protein synthesis kit (NEB, E6800) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: We used PURExpress In Vitro Protein Synthesis Kit (NEB, E6800L) and the reaction was set up with the following manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs) was used to translate the synthetic transcriptome described above ...
-
bioRxiv - Microbiology 2023Quote: ... proteins were removed using the Monarch RNA Cleanup Kit (NEB) and 5’-mono-phosphorylated v51_mut_S templates were specifically digested with a terminator 5’-phosphate-dependent exonuclease (Biosearch technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... kit and co-injected with Cas9 protein (New England Biolabs) into one-cell stage zebrafish eggs ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 1:8 dilution Cas9 protein (New England Biolabs, cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 units mL-1 lambda protein phosphatase (NEB), and 0.1 μg mL-1 protein phosphatase 2a (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... Ribosomal RNA (rRNA) was depleted using the rRNA depletion Kit (Human/Mouse/Rat) (New England BioLabs [NEB, USA]). Library preparation for total RNA sequencing was performed using NEBNext® UltraTM II RNA Library Preparation Kit for Illumina (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was depleted of ribosomal RNAs using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) (New England Biolabs) before they were used for library construction using NEBNext Ultra II Directional RNA Library Prep Kit (New England Biolabs) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Removal of rRNA was carried out by use of the NEBNext rRNA Depletion Kit Human/Mouse/Rat (NEB) followed by strand-specific cDNA NGS library preparation (NEBNext Ultra II Directional RNA Library Prep Kit for Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and rat (New England Biolabs, USA) that specifically depletes cytoplasmic (5S ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping was performed by amplifying a 619bp region around the cutting sites looking for acquired resistance to EcoRI (NEB) cutting and or bigger indels ...
-
bioRxiv - Bioengineering 2023Quote: ... previously described 34,51 containing the tetracycline resistance cassette and sacB3 gene via a three-fragment HiFi reaction (New England Biolabs). Escherichia coli S17-1 was transformed with the pMTL70641:ΔpilA construct and conjugated with C ...
-
bioRxiv - Bioengineering 2020Quote: IVPS was performed using PURExpress In Vitro Protein Synthesis Kit (NEB) with supplements (16 U RNase inhibitor (NEB) ...
-
bioRxiv - Microbiology 2023Quote: The PURExpress ΔRibosome In Vitro Protein Synthesis Kit (New England Biolabs) was used for in vitro translation assays ...
-
bioRxiv - Cell Biology 2023Quote: ... and 62.5 μL of Lambda Protein Phosphatase (New England Biolabs, 5 U μg-1 of protein) were added with gentle mixing after each addition ...
-
bioRxiv - Microbiology 2019Quote: ... in conjunction with the NEBNext® rRNA Depletion Kit for Human/Mouse/Rat (New England BioLabs, Ipswich, MA, USA) and the MICROBExpress kit (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: mRNA was enriched from 100ng DNase treated total RNA using the NEBNext rRNA depletion Kit (human, mouse, rat, NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... A 140-500 ng aliquot of total RNA was rRNA depleted using NEB’s Human/Mouse/Rat RNAse-H based Depletion kit (New England BioLabs). Following rRNA removal ...
-
bioRxiv - Cell Biology 2020Quote: ... 1 μL of Lambda Protein Phosphatase (New England Biolabs) or 1 μL of phosphatase inhibitor mix (20 mM β-glycerophosphate ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or 279bp (high cost) of regulatory region (Fig. S1) and cloned into pKD3 upstream of the chloramphenicol resistance cassette using Gibson Assembly (NEB). Primers to amplify hilD contained ∼40bp homology to the sites flanking a NdeI site in pKD3 ...
-
bioRxiv - Microbiology 2022Quote: ... of the SNAP-Tag-SCE-I-KanR shuttle sequence with a nine amino acid linker (HTEDPPVAT) and subsequent second recombination to clear the Kanamycin resistance and restore the SNAP-Tag sequence (NEB; for complete insertion sequence see Table 1) ...
-
bioRxiv - Microbiology 2021Quote: ... AGCTTGATATCAAGCTTGCATGCCTGCAGGTCAGAAGAACTCGTCAAGAAGGCGAT AGAA were used to amplify the Neomycin resistance cassette and assemble into CSIB linearized with and BstXI and SbfI using NEBuilder HiFi DNA Assembly (NEB). The 2xFYVE-mSCAR endosome labeling construct was constructed by adding 2 FYVE domains to the N-terminus of mScarlett ...
-
bioRxiv - Microbiology 2020Quote: ... these fragments were assembled to flank a kanamycin resistance cassette via isothermal assembly using the NEBuilder HiFi DNA Assembly MasterMix (New England Biolabs) and cloned into pMRKO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Genotyping was performed with PCR amplifying 253bp across the cutting sites and looking for acquired resistance to MspA1l digestion (NEB). Positive clones were further confirmed by immunoblotting ...
-
bioRxiv - Molecular Biology 2019Quote: ... The efficiency of the methylation reaction was verified by resistance to cleavage by the methylation-sensitive restriction enzyme HpaII (New England BioLabs). The methylated and mock-methylated chemerin promoter fragments were re-ligated into the parent vector ...
-
bioRxiv - Genetics 2021Quote: ... All four fragments (upstream and downstream homology arms together with mCherry and the puromycin resistance cassette) were cloned into an XbaI (NEB) linearized pUC19 plasmid (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... cassette was inserted between the VP30 gene and the blasticidin resistance marker by restriction enzyme digestion of the vector with SpeI-HF and SalI-HF (NEB), and digestion of a pEF1a-IRES vector (www.takarabio.com ...
-
bioRxiv - Microbiology 2022Quote: ... pGL-CPERlinker was assembled from synthetic DNA oligonucleotides and fragments (IDT) as well as the ampicillin resistance cassette and the origin of replication derived from pUC19 (NEB).
-
bioRxiv - Microbiology 2023Quote: ... The two flanking regions of the chosen genomic exchange region were amplified and joined with PCR fragment carrying antibiotic resistance cassette by overlapping PCR using Q5 polymerase (New England BioLabs). Next ...
-
bioRxiv - Genetics 2023Quote: ... The primers contained 60 bases pairs of homologies for the downstream and upstream region of the arcZ gene as well as homology with the kanamycin resistance gene (ArcZkanfor and ArcZkan) PCR was carried out with the Q5 2X Master Mix (New England Biolabs). The mixture was run in the thermocycler with a denaturation temperature of 95°C ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The origin of replication and antibiotic resistance gene fragments were obtained from source plasmids by PCR amplification with Q5 HiFi DNA polymerase (NEB). The multiple cloning site ...
-
bioRxiv - Cancer Biology 2023Quote: ... modified with an EF1a promoter and a Basticidin resistance gene using NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs). Specific primers and NEBuilder HiFi DNA Assembly Master Mix were used to introduce the exon E6a or the R238W mutation into the canonical sequence of NT5C2.
-
bioRxiv - Microbiology 2024Quote: ... into the HindIII and SpeI restriction sites of the pSEVA23a1 vector79 where a hygromycin resistance cassette had been inserted in BamHI and XbaI (all restriction enzymes were from New England Biolabs). Correct cloning was confirmed by Sanger sequencing (Eurofins) ...
-
bioRxiv - Cell Biology 2023Quote: ... The NAT resistance gene was generated by digested pRS416 with AscI and HindIII (R0558, R0104, New England Biolabs, Waltham, MA) to generate fragments of 9467bp and 1729bp ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were analysed by an MSD Elisa assay (Pacific Biolabs) using a CEP55 antibody (Novux ...
-
bioRxiv - Neuroscience 2021Quote: ... The polymerase chain reaction (PCR) was performed on a genomic rat DNA template using a Taq PCR Kit (New England Biolabs), and the subsequent PCR product was purified using a Qiagen PCR Purification Kit (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... 1 μg of total RNA was depleted of rRNA using NEBNext rRNA Depletion Kit (Human/Mouse/Rat) prior to cDNA synthesis primed with random hexanucleotide oligonucleotides (Random Primer 6, NEB). Sequencing library construction was carried out using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... or by ribodepletion with NEBNext Human/Mouse/Rat rRNA Depletion kit followed by library construction using the NEBNext Ultra II Directional RNA-Seq protocol (New England BioLabs). Illumina 2×151 paired end reads were generated either on the HiSeq 4000 or NovaSeq 6000 sequencing platforms (Illumina) ...
-
bioRxiv - Genomics 2021Quote: ... 500ng input RNA was treated using the NEBNext Human/Mouse/Rat rRNA Depletion kit and libraries were prepared following the NEBNext Ultra II Directional RNA-Seq protocol (New England BioLabs). Paired end 2×151 bp reads were produced using the HiSeq 4000 platform (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... rRNA depletion was performed using a NEBNext rRNA Depletion Kit v2 (Human/Mouse/Rat) and RNA was purified using Agencourt RNAClean XP Beads (New England Biolabs). Libraries were prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described in the instructions with minor modifications ...
-
bioRxiv - Microbiology 2023Quote: ... the PURExpress® In Vitro Protein Synthesis Kit (New England Biolabs, E6800L) was used as described previously (31) ...
-
bioRxiv - Genetics 2019Quote: ... and integrated with hygromycin resistance cassette amplified from plasmid pUMa1507 (Terfrüchte et al. 2014) by Gibson Assembly (New England Biolabs, Ipswich, USA).
-
bioRxiv - Genetics 2020Quote: ... and cloned it into a lentiviral transfer pLEX vector carrying the hygromycin resistance gene using Gibson Assembly Master Mix (NEB E2611L). A 2A epitope tag was added to hACE2 at the C-terminus ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the plasmids for the Blasticidin and Zeocin resistance marker-based systems were introduced to T7 Express chemically competent cells (NEB #C2566I) according to the manufacturer’s high-efficiency transformation protocols ...
-
bioRxiv - Microbiology 2023Quote: ... antibiotic resistance cassette and 2 flanking regions were combined in equimolar amounts and mixed with 2 x HiFi reagent (NEB, UK) and incubated at 50°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... both proteins were deglycosylated by PNGase F (NEB, 1:50) overnight at 37°C in PBS ...
-
bioRxiv - Synthetic Biology 2023Quote: The cell-free protein synthesis (CFPS) reactions were carried out using the PURExpress In Vitro Protein Synthesis Kit (New England Biolabs Inc) in 384-well plates (Thermofisher NUNC ...